Transcript: Human XM_005253709.4

PREDICTED: Homo sapiens integrin alpha FG-GAP repeat containing 2 (ITFG2), transcript variant X15, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ITFG2 (55846)
Length:
3131
CDS:
315..1127

Additional Resources:

NCBI RefSeq record:
XM_005253709.4
NBCI Gene record:
ITFG2 (55846)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005253709.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155875 CCAGGTTGTGCGTATGCAATT pLKO.1 390 CDS 100% 10.800 15.120 N ITFG2 n/a
2 TRCN0000156006 CCTGCCTCGTATATGTCACTT pLKO.1 883 CDS 100% 4.950 3.960 N ITFG2 n/a
3 TRCN0000440249 GCATGAGGAGGTAGTTGCATG pLKO_005 740 CDS 100% 4.050 3.240 N ITFG2 n/a
4 TRCN0000431483 ATGTCTCCACTCACCTAATTG pLKO_005 541 CDS 100% 13.200 9.240 N ITFG2 n/a
5 TRCN0000427033 ATTTGACTCTGGGCATGAAAG pLKO_005 1236 3UTR 100% 10.800 7.560 N ITFG2 n/a
6 TRCN0000152017 CCTAAAGGTATCTGTGGTATT pLKO.1 1180 3UTR 100% 10.800 7.560 N ITFG2 n/a
7 TRCN0000431854 TCCGCTTCCAAGTGGATGAAA pLKO_005 808 CDS 100% 5.625 3.938 N ITFG2 n/a
8 TRCN0000438038 AGGTGAGGGTCCTGAACATCT pLKO_005 263 5UTR 100% 4.950 3.465 N ITFG2 n/a
9 TRCN0000437145 AGTAGTGGCTCTGGCCTCTTT pLKO_005 591 CDS 100% 4.950 3.465 N ITFG2 n/a
10 TRCN0000154175 CGGTGAAAGAAGAGACAAGTT pLKO.1 1306 3UTR 100% 4.950 3.465 N ITFG2 n/a
11 TRCN0000152018 CGTATGCAATTCTACTGTGTA pLKO.1 400 CDS 100% 4.950 3.465 N ITFG2 n/a
12 TRCN0000153467 GAGTCTACCAATCTGGTGAAA pLKO.1 951 CDS 100% 4.950 3.465 N ITFG2 n/a
13 TRCN0000438371 GACATCTGGCCGTATCCACAA pLKO_005 515 CDS 100% 4.050 2.835 N ITFG2 n/a
14 TRCN0000138395 CCTTCCAAGTAGCTGGGATTA pLKO.1 2816 3UTR 100% 10.800 5.400 Y C11orf88 n/a
15 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2955 3UTR 100% 5.625 2.813 Y KLHL30 n/a
16 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2955 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005253709.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03665 pDONR223 100% 60.4% 60.4% None 0_1ins531 n/a
2 ccsbBroad304_03665 pLX_304 0% 60.4% 60.4% V5 0_1ins531 n/a
3 TRCN0000472774 GATTACGCAACGGCCTTGCCCTGT pLX_317 38.4% 60.4% 60.4% V5 0_1ins531 n/a
Download CSV