Transcript: Human XM_005254070.2

PREDICTED: Homo sapiens tripeptidyl peptidase 2 (TPP2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TPP2 (7174)
Length:
4827
CDS:
55..3969

Additional Resources:

NCBI RefSeq record:
XM_005254070.2
NBCI Gene record:
TPP2 (7174)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005254070.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303664 TCATGTATCCTCCCGATTATT pLKO_005 3938 CDS 100% 15.000 21.000 N TPP2 n/a
2 TRCN0000051393 GCTGGATTCTAGTGACATTTA pLKO.1 3198 CDS 100% 13.200 18.480 N TPP2 n/a
3 TRCN0000299615 GCTGGATTCTAGTGACATTTA pLKO_005 3198 CDS 100% 13.200 18.480 N TPP2 n/a
4 TRCN0000051397 GCCCACTACTTTGTGAACTAT pLKO.1 2573 CDS 100% 5.625 7.875 N TPP2 n/a
5 TRCN0000051396 CCTGTATATGACTGCTTGGTA pLKO.1 631 CDS 100% 3.000 4.200 N TPP2 n/a
6 TRCN0000303666 CACTATCCAGTACTGATTATT pLKO_005 4069 3UTR 100% 15.000 10.500 N TPP2 n/a
7 TRCN0000263387 GCCTGATGCAGCTACTATAAA pLKO_005 3402 CDS 100% 15.000 10.500 N Tpp2 n/a
8 TRCN0000303665 CTCGTTCAGAATACATCATTT pLKO_005 1585 CDS 100% 13.200 9.240 N TPP2 n/a
9 TRCN0000051395 CGCCTTAAAGACCTTCCATTT pLKO.1 2758 CDS 100% 10.800 7.560 N TPP2 n/a
10 TRCN0000299614 CGCCTTAAAGACCTTCCATTT pLKO_005 2758 CDS 100% 10.800 7.560 N TPP2 n/a
11 TRCN0000032849 GCAGGTTACAACTGATGGAAA pLKO.1 216 CDS 100% 4.950 3.465 N Tpp2 n/a
12 TRCN0000051394 CCTGATCCTTTCAGGTCTGAA pLKO.1 1434 CDS 100% 0.495 0.347 N TPP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005254070.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07095 pDONR223 100% 95.7% 95.7% None 780T>C;2953_2991del;3372_3497del n/a
2 ccsbBroad304_07095 pLX_304 0% 95.7% 95.7% V5 780T>C;2953_2991del;3372_3497del n/a
3 TRCN0000474567 GTCTACCCTCTACGCCCCATACAC pLX_317 10.8% 95.7% 95.7% V5 780T>C;2953_2991del;3372_3497del n/a
Download CSV