Transcript: Human XM_005254146.4

PREDICTED: Homo sapiens DIS3 like exosome 3'-5' exoribonuclease (DIS3L), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DIS3L (115752)
Length:
3921
CDS:
2..2548

Additional Resources:

NCBI RefSeq record:
XM_005254146.4
NBCI Gene record:
DIS3L (115752)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005254146.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154139 CGGGATTATGTGGTGACATTT pLKO.1 1028 CDS 100% 13.200 18.480 N DIS3L n/a
2 TRCN0000350506 GAACAAGGGCCACCACTTATT pLKO_005 1569 CDS 100% 13.200 10.560 N DIS3L n/a
3 TRCN0000315302 TGGTATGGCAGAACCATTATT pLKO_005 1727 CDS 100% 15.000 10.500 N DIS3L n/a
4 TRCN0000151790 CCCACTTTACTTCTCCAATAA pLKO.1 2379 CDS 100% 13.200 9.240 N DIS3L n/a
5 TRCN0000315360 ACGCAGCTGTTTGGTACTATC pLKO_005 435 CDS 100% 10.800 7.560 N DIS3L n/a
6 TRCN0000153835 CCACGAGCTTTGTGATTCTAT pLKO.1 598 CDS 100% 5.625 3.938 N DIS3L n/a
7 TRCN0000152818 GCATATACAACGCAGCTGTTT pLKO.1 426 CDS 100% 4.950 3.465 N DIS3L n/a
8 TRCN0000152538 GCGTCATGATTGCATTCTCTT pLKO.1 331 CDS 100% 4.950 3.465 N DIS3L n/a
9 TRCN0000152988 GAGTTCCATCATTACGGTCTT pLKO.1 2342 CDS 100% 4.050 2.835 N DIS3L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005254146.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09421 pDONR223 100% 72.3% 72.2% None (many diffs) n/a
2 ccsbBroad304_09421 pLX_304 0% 72.3% 72.2% V5 (many diffs) n/a
3 TRCN0000479100 TCCCGTAAGACTGGGTCGTATCCT pLX_317 13.5% 72.3% 72.2% V5 (many diffs) n/a
Download CSV