Transcript: Human XM_005254287.2

PREDICTED: Homo sapiens transmembrane protein 87A (TMEM87A), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM87A (25963)
Length:
2882
CDS:
36..1706

Additional Resources:

NCBI RefSeq record:
XM_005254287.2
NBCI Gene record:
TMEM87A (25963)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005254287.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142819 CCCTATGAATACCTCACACTT pLKO.1 678 CDS 100% 4.950 6.930 N TMEM87A n/a
2 TRCN0000143692 GCAGTTAAAGATGGCTACCAT pLKO.1 1722 3UTR 100% 3.000 4.200 N TMEM87A n/a
3 TRCN0000144037 CGGAATTTCAGAATATCCGAT pLKO.1 868 CDS 100% 2.640 3.696 N TMEM87A n/a
4 TRCN0000144308 CAATGCATGAACCATTGCAAA pLKO.1 541 CDS 100% 0.495 0.693 N TMEM87A n/a
5 TRCN0000143788 GCTGTCTTCTATGCGGAATTT pLKO.1 855 CDS 100% 13.200 9.240 N TMEM87A n/a
6 TRCN0000144609 GCTTCAGAAGTTGTAGCTTAT pLKO.1 2592 3UTR 100% 10.800 7.560 N TMEM87A n/a
7 TRCN0000143983 CCTCTTCAGAAATACCACTAT pLKO.1 209 CDS 100% 4.950 3.465 N TMEM87A n/a
8 TRCN0000144326 CCTTACCTTTATTGGAGACAA pLKO.1 515 CDS 100% 4.950 3.465 N TMEM87A n/a
9 TRCN0000144956 GAACGAATGATCACACACTTT pLKO.1 1665 CDS 100% 4.950 3.465 N TMEM87A n/a
10 TRCN0000145386 GCATTTCATCCTCAAAGGAAT pLKO.1 601 CDS 100% 4.950 3.465 N TMEM87A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005254287.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02892 pDONR223 100% 31.9% 30.5% None (many diffs) n/a
2 ccsbBroad304_02892 pLX_304 0% 31.9% 30.5% V5 (many diffs) n/a
3 TRCN0000475159 GCAATGTCCTAGTCAAAGCCACCT pLX_317 59.6% 31.9% 30.5% V5 (many diffs) n/a
Download CSV