Transcript: Human XM_005255453.5

PREDICTED: Homo sapiens myocardin related transcription factor B (MRTFB), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MRTFB (57496)
Length:
9467
CDS:
833..4132

Additional Resources:

NCBI RefSeq record:
XM_005255453.5
NBCI Gene record:
MRTFB (57496)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005255453.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232301 GACACTTTCACCGAGATTATG pLKO_005 2402 CDS 100% 13.200 18.480 N MRTFB n/a
2 TRCN0000232303 ACGTTAGGATTCTGGTAATTA pLKO_005 4457 3UTR 100% 15.000 12.000 N MRTFB n/a
3 TRCN0000015397 GCCAGCTTAGAGAACCAACTA pLKO.1 3758 CDS 100% 4.950 3.960 N MRTFB n/a
4 TRCN0000369296 CAAAGACGACTCATCTATTTC pLKO_005 4365 3UTR 100% 13.200 9.240 N MRTFB n/a
5 TRCN0000015393 CCAGTGTTAAAGAAGCAATTA pLKO.1 1323 CDS 100% 13.200 9.240 N MRTFB n/a
6 TRCN0000369298 GGTCACTTTAAGACCCTAAAT pLKO_005 4495 3UTR 100% 13.200 9.240 N MRTFB n/a
7 TRCN0000232299 GTGTTAAAGAAGCAATTATAG pLKO_005 1326 CDS 100% 13.200 9.240 N MRTFB n/a
8 TRCN0000369370 TCTAGCCTGGATGACTTAAAG pLKO_005 2024 CDS 100% 13.200 9.240 N MRTFB n/a
9 TRCN0000232302 TGTCGTCCAGCACTCTCTATT pLKO_005 3427 CDS 100% 13.200 9.240 N MRTFB n/a
10 TRCN0000369299 TTTACCCTCAGCCAATGAAAT pLKO_005 3799 CDS 100% 13.200 9.240 N MRTFB n/a
11 TRCN0000232300 GATCCCAAACCACGGGTAAAG pLKO_005 1715 CDS 100% 10.800 7.560 N MRTFB n/a
12 TRCN0000369368 GGACCTCATTGAGCGCCTAAA pLKO_005 2104 CDS 100% 10.800 7.560 N MRTFB n/a
13 TRCN0000015394 GCAGACACTTTCACCGAGATT pLKO.1 2399 CDS 100% 4.950 3.465 N MRTFB n/a
14 TRCN0000280403 GCAGACACTTTCACCGAGATT pLKO_005 2399 CDS 100% 4.950 3.465 N MRTFB n/a
15 TRCN0000015396 GCCGGTTACAACACTACACAA pLKO.1 2227 CDS 100% 4.950 3.465 N MRTFB n/a
16 TRCN0000015395 CCTCATTAAGAGTGGAGAGAT pLKO.1 3580 CDS 100% 4.950 2.970 N MRTFB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005255453.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12353 pDONR223 100% 31.3% 28.2% None (many diffs) n/a
2 ccsbBroad304_12353 pLX_304 0% 31.3% 28.2% V5 (many diffs) n/a
3 TRCN0000467244 CGATCCCTGGTATGATTTCTCTGG pLX_317 31.4% 31.3% 28.2% V5 (many diffs) n/a
Download CSV