Transcript: Human XM_005255861.5

PREDICTED: Homo sapiens Gse1 coiled-coil protein (GSE1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GSE1 (23199)
Length:
9395
CDS:
176..5734

Additional Resources:

NCBI RefSeq record:
XM_005255861.5
NBCI Gene record:
GSE1 (23199)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005255861.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147447 GCAGTTTAGATGCTGTGAAAT pLKO.1 9242 3UTR 100% 13.200 18.480 N GSE1 n/a
2 TRCN0000434061 GAACTCACCTTGACGTCAATG pLKO_005 5891 3UTR 100% 10.800 15.120 N GSE1 n/a
3 TRCN0000412761 CTGAGCATGCTTCACTATATC pLKO_005 5036 CDS 100% 13.200 9.240 N GSE1 n/a
4 TRCN0000432641 TACGACCTCGATGACTCTTAC pLKO_005 4349 CDS 100% 10.800 7.560 N GSE1 n/a
5 TRCN0000421450 GATATCCCAGGTGACGGTTTC pLKO_005 5721 CDS 100% 6.000 4.200 N GSE1 n/a
6 TRCN0000130850 GAAGCTTACCAGGAACACATA pLKO.1 5471 CDS 100% 4.950 3.465 N GSE1 n/a
7 TRCN0000127686 GATGAACAACAGTCCCAACTT pLKO.1 4639 CDS 100% 4.950 3.465 N GSE1 n/a
8 TRCN0000127711 GCCAGTATTATCAGCAGTCAA pLKO.1 7540 3UTR 100% 4.950 3.465 N GSE1 n/a
9 TRCN0000149840 CAGGAACACATAGAAGAGCAA pLKO.1 5480 CDS 100% 2.640 1.848 N GSE1 n/a
10 TRCN0000130787 GCTGAGAAGAGGAAAGACAAA pLKO.1 4709 CDS 100% 4.950 2.970 N GSE1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005255861.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07852 pDONR223 100% 60% 60% None 1_2217del;4712T>C n/a
2 ccsbBroad304_07852 pLX_304 0% 60% 60% V5 1_2217del;4712T>C n/a
3 TRCN0000479184 CGAGTCAGGCCAAGCGTAAAACTA pLX_317 11.6% 60% 60% V5 1_2217del;4712T>C n/a
Download CSV