Transcript: Human XM_005255955.5

PREDICTED: Homo sapiens carbohydrate sulfotransferase 6 (CHST6), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CHST6 (4166)
Length:
3798
CDS:
739..1926

Additional Resources:

NCBI RefSeq record:
XM_005255955.5
NBCI Gene record:
CHST6 (4166)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005255955.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036164 CATAACATCACCCACGGATCT pLKO.1 1648 CDS 100% 4.050 2.835 N CHST6 n/a
2 TRCN0000036168 GTGTTTGATGCCTATCTGCCT pLKO.1 1054 CDS 100% 0.660 0.462 N CHST6 n/a
3 TRCN0000036165 CCGCAACCTGTCCGACCTCTT pLKO.1 1080 CDS 100% 0.000 0.000 N CHST6 n/a
4 TRCN0000036166 GCTGGCAGAAATCCGTGCGCT pLKO.1 1578 CDS 100% 0.000 0.000 N CHST6 n/a
5 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 3709 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005255955.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00984 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00984 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000476758 CTTATATGGGCAACACTCGCCGTC pLX_317 32.1% 100% 100% V5 n/a
4 ccsbBroadEn_02796 pDONR223 100% 82.1% 79.8% None (many diffs) n/a
5 ccsbBroad304_02796 pLX_304 0% 82.1% 79.8% V5 (many diffs) n/a
6 TRCN0000478129 AGTCCTGCGACTCTTTAGTAAACC pLX_317 14.4% 82.1% 79.8% V5 (many diffs) n/a
Download CSV