Transcript: Human XM_005256215.1

PREDICTED: Homo sapiens NEDD8 activating enzyme E1 subunit 1 (NAE1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NAE1 (8883)
Length:
1783
CDS:
315..1652

Additional Resources:

NCBI RefSeq record:
XM_005256215.1
NBCI Gene record:
NAE1 (8883)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005256215.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007241 GCCATGGAATTCTTACAAGAA pLKO.1 312 5UTR 100% 0.000 0.000 N NAE1 n/a
2 TRCN0000293363 GCCATGGAATTCTTACAAGAA pLKO_005 312 5UTR 100% 0.000 0.000 N NAE1 n/a
3 TRCN0000007239 CGCTGCATAAATATCACCAAA pLKO.1 924 CDS 100% 4.950 3.960 N NAE1 n/a
4 TRCN0000412912 ATAGAATCTCATCCAGATAAT pLKO_005 561 CDS 100% 13.200 9.240 N Nae1 n/a
5 TRCN0000007238 CCAAGCAGTATTGAAGATATA pLKO.1 891 CDS 100% 13.200 9.240 N NAE1 n/a
6 TRCN0000293362 CCAAGCAGTATTGAAGATATA pLKO_005 891 CDS 100% 13.200 9.240 N NAE1 n/a
7 TRCN0000007240 CCAGGAGTATCTAACTATCAA pLKO.1 1374 CDS 100% 5.625 3.938 N NAE1 n/a
8 TRCN0000293293 CCAGGAGTATCTAACTATCAA pLKO_005 1374 CDS 100% 5.625 3.938 N NAE1 n/a
9 TRCN0000112479 CCTGATATGATTGCAGATTCA pLKO.1 1035 CDS 100% 4.950 3.465 N Nae1 n/a
10 TRCN0000007242 GCATGTCACAAACTTCAGCAA pLKO.1 1618 CDS 100% 2.640 1.848 N NAE1 n/a
11 TRCN0000293361 GCATGTCACAAACTTCAGCAA pLKO_005 1618 CDS 100% 2.640 1.848 N NAE1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005256215.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02040 pDONR223 100% 83.3% 83.3% None 0_1ins267 n/a
2 ccsbBroad304_02040 pLX_304 0% 83.3% 83.3% V5 0_1ins267 n/a
3 TRCN0000470601 GAATTGAGCCACAAATCTGGGACA pLX_317 18.6% 83.3% 83.3% V5 0_1ins267 n/a
Download CSV