Transcript: Human XM_005256399.5

PREDICTED: Homo sapiens tubulin folding cofactor D (TBCD), transcript variant X13, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TBCD (6904)
Length:
2747
CDS:
212..2506

Additional Resources:

NCBI RefSeq record:
XM_005256399.5
NBCI Gene record:
TBCD (6904)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005256399.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303636 CACAAATGTGCTTCCTATAAA pLKO_005 2712 3UTR 100% 15.000 21.000 N TBCD n/a
2 TRCN0000117361 GCTCTATGATCGTCAGTTATA pLKO.1 910 CDS 100% 13.200 18.480 N TBCD n/a
3 TRCN0000299472 GCTCTATGATCGTCAGTTATA pLKO_005 910 CDS 100% 13.200 18.480 N TBCD n/a
4 TRCN0000117359 CCGTAATTGATGGTTGGCAAT pLKO.1 1020 CDS 100% 4.050 5.670 N TBCD n/a
5 TRCN0000299471 CCGTAATTGATGGTTGGCAAT pLKO_005 1020 CDS 100% 4.050 5.670 N TBCD n/a
6 TRCN0000117360 CGGTAACAGATCCAACTGTTT pLKO.1 544 CDS 100% 0.495 0.693 N TBCD n/a
7 TRCN0000331648 CGGTAACAGATCCAACTGTTT pLKO_005 544 CDS 100% 0.495 0.693 N TBCD n/a
8 TRCN0000369697 TTTGACCACAGCTGACTATTT pLKO_005 517 CDS 100% 13.200 9.240 N TBCD n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005256399.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15606 pDONR223 0% 81.4% 81.2% None (many diffs) n/a
2 ccsbBroad304_15606 pLX_304 0% 81.4% 81.2% V5 (many diffs) n/a
3 ccsbBroadEn_15605 pDONR223 0% 26.6% 23.1% None (many diffs) n/a
4 ccsbBroad304_15605 pLX_304 0% 26.6% 23.1% V5 (many diffs) n/a
Download CSV