Transcript: Human XM_005256572.2

PREDICTED: Homo sapiens WSC domain containing 1 (WSCD1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WSCD1 (23302)
Length:
5900
CDS:
407..2134

Additional Resources:

NCBI RefSeq record:
XM_005256572.2
NBCI Gene record:
WSCD1 (23302)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005256572.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135200 CGGTTAGAACAGAACAGAGAA pLKO.1 4676 3UTR 100% 4.950 6.930 N WSCD1 n/a
2 TRCN0000135544 GAGTGTAACCATGAGTGCAAA pLKO.1 1031 CDS 100% 4.950 6.930 N WSCD1 n/a
3 TRCN0000135071 CGAACACAAATGGACACACAT pLKO.1 2311 3UTR 100% 4.950 3.465 N WSCD1 n/a
4 TRCN0000137011 CTGCCAGAGAACATCACACAT pLKO.1 1166 CDS 100% 4.950 3.465 N WSCD1 n/a
5 TRCN0000136574 CTGTGCAAGACACTCGTTGTA pLKO.1 1407 CDS 100% 4.950 3.465 N WSCD1 n/a
6 TRCN0000134281 GCCTAACAAATCCAAAGTGTT pLKO.1 1444 CDS 100% 4.950 3.465 N WSCD1 n/a
7 TRCN0000135597 GTTCCTGCCTAACAAATCCAA pLKO.1 1438 CDS 100% 3.000 2.100 N WSCD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005256572.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07864 pDONR223 100% 99.8% 99.6% None 634C>T;1095A>G;1715A>C n/a
2 ccsbBroad304_07864 pLX_304 0% 99.8% 99.6% V5 634C>T;1095A>G;1715A>C n/a
3 TRCN0000477477 TCTCTCGCAAATTAAACTGCAGCC pLX_317 22.6% 99.8% 99.6% V5 634C>T;1095A>G;1715A>C n/a
Download CSV