Transcript: Human XM_005256753.3

PREDICTED: Homo sapiens mitogen-activated protein kinase kinase 4 (MAP2K4), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAP2K4 (6416)
Length:
3636
CDS:
235..1080

Additional Resources:

NCBI RefSeq record:
XM_005256753.3
NBCI Gene record:
MAP2K4 (6416)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001145028 CCAGAGAATTCGGTCAACAG pXPR_003 TGG 52 6% 3 0.2296 MAP2K4 MAP2K4 76650
2 BRDN0001145410 TTTGTAAAACTTATCAAACG pXPR_003 AGG 199 24% 4 -0.5929 MAP2K4 MAP2K4 76651
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005256753.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039917 GCTCTCCCATGTATGTCGATT pLKO.1 1058 CDS 100% 4.950 6.930 N MAP2K4 n/a
2 TRCN0000001389 CCTGTGGTCTATTGTCGCTAT pLKO.1 2196 3UTR 100% 4.050 5.670 N MAP2K4 n/a
3 TRCN0000025267 CTTCTGAAACATCCCTTTATT pLKO.1 961 CDS 100% 15.000 10.500 N Map2k4 n/a
4 TRCN0000345139 CTTCTGAAACATCCCTTTATT pLKO_005 961 CDS 100% 15.000 10.500 N Map2k4 n/a
5 TRCN0000010496 TACATTGTGAGCTCTGGTTAT pLKO.1 3282 3UTR 100% 10.800 7.560 N MAP2K4 n/a
6 TRCN0000197261 GCATCACGACAAGGATATGAT pLKO.1 715 CDS 100% 5.625 3.938 N MAP2K4 n/a
7 TRCN0000001390 CTTCTTATGGATTTGGATGTA pLKO.1 313 CDS 100% 4.950 3.465 N MAP2K4 n/a
8 TRCN0000197078 GATGTAGTAATGCGGAGTAGT pLKO.1 328 CDS 100% 4.950 3.465 N MAP2K4 n/a
9 TRCN0000001393 GATATGATGTCCGCTCTGATG pLKO.1 728 CDS 100% 4.050 2.835 N MAP2K4 n/a
10 TRCN0000001392 ACGAGGAGCTTATGGTTCTGT pLKO.1 207 5UTR 100% 3.000 2.100 N MAP2K4 n/a
11 TRCN0000001391 GATGTATGAAGAACGTGCCGT pLKO.1 984 CDS 100% 0.660 0.462 N MAP2K4 n/a
12 TRCN0000196996 GACAGCTTGTGGACTCTATTG pLKO.1 635 CDS 100% 10.800 6.480 N MAP2K4 n/a
13 TRCN0000039914 CCAAAGTGGAATAGTGTATTT pLKO.1 802 CDS 100% 13.200 6.600 Y MAP2K4 n/a
14 TRCN0000039915 GTGGGCAAATAATGGCAGTTA pLKO.1 251 CDS 100% 4.950 2.475 Y MAP2K4 n/a
15 TRCN0000010495 CAACTTGTGCCTTACGAAGGA pLKO.1 912 CDS 100% 2.640 1.320 Y MAP2K4 n/a
16 TRCN0000039913 ACATTGTGAGCTCTGGTTATC pLKO.1 3283 3UTR 100% 10.800 7.560 N MAP2K4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005256753.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489440 AAACTTTGGGGGACTTTCACTCAG pLX_317 26.9% 70.4% 70.4% V5 (not translated due to prior stop codon) 0_1ins354 n/a
Download CSV