Transcript: Human XM_005257670.1

PREDICTED: Homo sapiens rhomboid 5 homolog 2 (RHBDF2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RHBDF2 (79651)
Length:
3475
CDS:
252..2735

Additional Resources:

NCBI RefSeq record:
XM_005257670.1
NBCI Gene record:
RHBDF2 (79651)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005257670.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000312619 CCGCGTGAGATGGTTGGTTAA pLKO_005 2893 3UTR 100% 10.800 15.120 N RHBDF2 n/a
2 TRCN0000048684 CACGGCTATTTCCATGAGGAA pLKO.1 2022 CDS 100% 2.640 2.112 N RHBDF2 n/a
3 TRCN0000327759 CACGGCTATTTCCATGAGGAA pLKO_005 2022 CDS 100% 2.640 2.112 N RHBDF2 n/a
4 TRCN0000048686 CTCGTGTCTGTGGTCTTTCAA pLKO.1 2175 CDS 100% 5.625 3.938 N RHBDF2 n/a
5 TRCN0000363571 CTCGTGTCTGTGGTCTTTCAA pLKO_005 2175 CDS 100% 5.625 3.938 N RHBDF2 n/a
6 TRCN0000048685 GTGAAGCACTTTGCCTTTGAT pLKO.1 1233 CDS 100% 5.625 3.938 N RHBDF2 n/a
7 TRCN0000363570 GTGAAGCACTTTGCCTTTGAT pLKO_005 1233 CDS 100% 5.625 3.938 N RHBDF2 n/a
8 TRCN0000048687 CAAATCCCTCTGAAGGAGTAT pLKO.1 1161 CDS 100% 4.950 3.465 N RHBDF2 n/a
9 TRCN0000327758 CAAATCCCTCTGAAGGAGTAT pLKO_005 1161 CDS 100% 4.950 3.465 N RHBDF2 n/a
10 TRCN0000048683 GACACGTTTGACTCCTCCTTT pLKO.1 1023 CDS 100% 4.950 3.465 N RHBDF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005257670.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12583 pDONR223 100% 74.8% 74.8% None 1_624del n/a
2 ccsbBroad304_12583 pLX_304 0% 74.8% 74.8% V5 1_624del n/a
3 TRCN0000468604 ATCATTTCAATCTCAATGCATTGT pLX_317 20.6% 74.8% 74.8% V5 1_624del n/a
Download CSV