Transcript: Human XM_005258070.5

PREDICTED: Homo sapiens golgi SNAP receptor complex member 1 (GOSR1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GOSR1 (9527)
Length:
1455
CDS:
118..1020

Additional Resources:

NCBI RefSeq record:
XM_005258070.5
NBCI Gene record:
GOSR1 (9527)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005258070.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379866 ATGGAAGACGCGACAGGTATA pLKO_005 398 CDS 100% 10.800 15.120 N GOSR1 n/a
2 TRCN0000060386 CGATTGAGATTGAACAACTTT pLKO.1 479 CDS 100% 5.625 7.875 N GOSR1 n/a
3 TRCN0000060383 GCGACAGGTATAGTTCTGATA pLKO.1 407 CDS 100% 4.950 6.930 N GOSR1 n/a
4 TRCN0000380057 ACGGGAAAGGGAGAATCTTAT pLKO_005 663 CDS 100% 13.200 9.240 N GOSR1 n/a
5 TRCN0000380138 AGAGGAATGTTGAAGTCAATT pLKO_005 850 CDS 100% 13.200 9.240 N GOSR1 n/a
6 TRCN0000379765 AGCAAACTATGTACAAGTTAC pLKO_005 358 CDS 100% 10.800 7.560 N GOSR1 n/a
7 TRCN0000379791 GAAACTCAGATCGTCTGATAG pLKO_005 779 CDS 100% 10.800 7.560 N GOSR1 n/a
8 TRCN0000381471 GGATCAAGCCAAGACAGAATG pLKO_005 445 CDS 100% 10.800 7.560 N GOSR1 n/a
9 TRCN0000381161 TGATAGTGTTGAAGCCTAATG pLKO_005 1322 3UTR 100% 10.800 7.560 N GOSR1 n/a
10 TRCN0000060385 CGAAACTCAGATCGTCTGATA pLKO.1 778 CDS 100% 4.950 3.465 N GOSR1 n/a
11 TRCN0000381115 GAACACTTTGGCCAATCGTTT pLKO_005 882 CDS 100% 4.950 3.465 N GOSR1 n/a
12 TRCN0000060387 CAAAGCAAACTTTATGGCAAT pLKO.1 642 CDS 100% 4.050 2.835 N GOSR1 n/a
13 TRCN0000060384 GCAGGATTATACACATGAATT pLKO.1 612 CDS 100% 0.000 0.000 N GOSR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005258070.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14022 pDONR223 100% 48.8% 34.6% None (many diffs) n/a
2 ccsbBroad304_14022 pLX_304 0% 48.8% 34.6% V5 (many diffs) n/a
3 TRCN0000468369 TGGCCCGAAACGGGTGGCTGAATA pLX_317 69.9% 48.8% 34.6% V5 (many diffs) n/a
Download CSV