Transcript: Human XM_005258951.3

PREDICTED: Homo sapiens kallikrein related peptidase 12 (KLK12), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KLK12 (43849)
Length:
1697
CDS:
863..1198

Additional Resources:

NCBI RefSeq record:
XM_005258951.3
NBCI Gene record:
KLK12 (43849)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005258951.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000372696 GGGTGTCCTTATTGACCACAG pLKO_005 1006 CDS 100% 2.250 3.150 N KLK12 n/a
2 TRCN0000049925 AGGCAGCCACACCGAAGATTT pLKO.1 909 CDS 100% 13.200 9.240 N KLK12 n/a
3 TRCN0000049923 CGGGAGAATCACGAGCAACAT pLKO.1 1133 CDS 100% 4.950 3.465 N KLK12 n/a
4 TRCN0000372695 GAGTCCTTCAAGGTCTGGTGT pLKO_005 1225 3UTR 100% 2.640 1.848 N KLK12 n/a
5 TRCN0000049927 GCATCCCTGGAGTCTACACCT pLKO.1 1279 3UTR 100% 0.880 0.616 N KLK12 n/a
6 TRCN0000049924 CCAGTGCCTCAACCTCTCCAT pLKO.1 1079 CDS 100% 0.880 0.528 N KLK12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005258951.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11922 pDONR223 100% 52.3% 11.7% None 1_70del;333_334ins169 n/a
2 ccsbBroad304_11922 pLX_304 0% 52.3% 11.7% V5 1_70del;333_334ins169 n/a
3 TRCN0000476654 GGACAGAGAGTCTGTGATTTCTCC pLX_317 61.7% 52.3% 11.7% V5 1_70del;333_334ins169 n/a
Download CSV