Transcript: Human XM_005260173.1

PREDICTED: Homo sapiens kelch like ECH associated protein 1 (KEAP1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KEAP1 (9817)
Length:
2726
CDS:
325..2199

Additional Resources:

NCBI RefSeq record:
XM_005260173.1
NBCI Gene record:
KEAP1 (9817)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005260173.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154657 GCGAATGATCACAGCAATGAA pLKO.1 1815 CDS 100% 5.625 4.500 N KEAP1 n/a
2 TRCN0000155340 GCACTGCAAATAACCCATCTT pLKO.1 2285 3UTR 100% 4.950 3.465 N KEAP1 n/a
3 TRCN0000280682 GCACTGCAAATAACCCATCTT pLKO_005 2285 3UTR 100% 4.950 3.465 N KEAP1 n/a
4 TRCN0000154656 GCCTTAATTCAGCTGAGTGTT pLKO.1 1772 CDS 100% 4.950 3.465 N KEAP1 n/a
5 TRCN0000280617 GCCTTAATTCAGCTGAGTGTT pLKO_005 1772 CDS 100% 4.950 3.465 N KEAP1 n/a
6 TRCN0000156676 GTGGCGAATGATCACAGCAAT pLKO.1 1812 CDS 100% 4.950 3.465 N KEAP1 n/a
7 TRCN0000280683 GTGGCGAATGATCACAGCAAT pLKO_005 1812 CDS 100% 4.950 3.465 N KEAP1 n/a
8 TRCN0000156309 CAGATTGACCAGCAGAACTGT pLKO.1 2170 CDS 100% 3.000 2.100 N KEAP1 n/a
9 TRCN0000158081 CGGGAGTACATCTACATGCAT pLKO.1 934 CDS 100% 3.000 2.100 N KEAP1 n/a
10 TRCN0000280616 CGGGAGTACATCTACATGCAT pLKO_005 934 CDS 100% 3.000 2.100 N KEAP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005260173.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10450 pDONR223 100% 99.9% 99.8% None 1870T>A n/a
2 ccsbBroad304_10450 pLX_304 0% 99.9% 99.8% V5 1870T>A n/a
Download CSV