Transcript: Human XM_005260949.4

PREDICTED: Homo sapiens ubiquitin specific peptidase 25 (USP25), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
USP25 (29761)
Length:
3880
CDS:
131..2296

Additional Resources:

NCBI RefSeq record:
XM_005260949.4
NBCI Gene record:
USP25 (29761)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005260949.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004366 GCACTTCTCCTGTTGACGATA pLKO.1 312 CDS 100% 4.950 6.930 N USP25 n/a
2 TRCN0000318646 GCACTTCTCCTGTTGACGATA pLKO_005 312 CDS 100% 4.950 6.930 N USP25 n/a
3 TRCN0000004370 TGGAGGAGTAAGATGAAATAT pLKO.1 3603 3UTR 100% 15.000 10.500 N USP25 n/a
4 TRCN0000004367 GCTGTAGAAGATATGAGAAAT pLKO.1 2069 CDS 100% 13.200 9.240 N USP25 n/a
5 TRCN0000318647 GCTGTAGAAGATATGAGAAAT pLKO_005 2069 CDS 100% 13.200 9.240 N USP25 n/a
6 TRCN0000004368 GCTGTTCCTCATCTGTGCTTA pLKO.1 1819 CDS 100% 4.950 3.465 N USP25 n/a
7 TRCN0000349572 GCTGTTCCTCATCTGTGCTTA pLKO_005 1819 CDS 100% 4.950 3.465 N USP25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005260949.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03088 pDONR223 100% 57.8% 57.8% None 0_1ins1212;1125_1334del n/a
2 ccsbBroad304_03088 pLX_304 0% 57.8% 57.8% V5 0_1ins1212;1125_1334del n/a
3 TRCN0000467162 GTTAGACCGGTCGCTGGTCCGGGT pLX_317 14.4% 57.8% 57.8% V5 0_1ins1212;1125_1334del n/a
4 ccsbBroadEn_11902 pDONR223 100% 48.4% 31.3% None (many diffs) n/a
5 ccsbBroad304_11902 pLX_304 0% 48.4% 31.3% V5 (many diffs) n/a
Download CSV