Transcript: Human XM_005261282.4

PREDICTED: Homo sapiens ess-2 splicing factor homolog (ESS2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ESS2 (8220)
Length:
1737
CDS:
43..1476

Additional Resources:

NCBI RefSeq record:
XM_005261282.4
NBCI Gene record:
ESS2 (8220)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005261282.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063891 CGCAAAGCTTCGGACTTCTTT pLKO.1 1453 CDS 100% 5.625 7.875 N ESS2 n/a
2 TRCN0000063889 TGAGAGTTGAAGGGTCGGAAA pLKO.1 1022 CDS 100% 4.050 5.670 N ESS2 n/a
3 TRCN0000306923 TGCCAAGCTGTTTGCTGTTTA pLKO_005 1674 3UTR 100% 13.200 9.240 N ESS2 n/a
4 TRCN0000306924 GCTACACGAGTGAGGACAATG pLKO_005 506 CDS 100% 10.800 7.560 N ESS2 n/a
5 TRCN0000063888 CAAAGGGATTTCTTTCCTGAT pLKO.1 196 CDS 100% 4.050 2.835 N ESS2 n/a
6 TRCN0000063890 GCAGAAAGATAATCTCGAACT pLKO.1 618 CDS 100% 4.050 2.835 N ESS2 n/a
7 TRCN0000298260 GCAGAAAGATAATCTCGAACT pLKO_005 618 CDS 100% 4.050 2.835 N ESS2 n/a
8 TRCN0000063892 GAATGGAGACTTGGAACGGAT pLKO.1 261 CDS 100% 2.640 1.848 N ESS2 n/a
9 TRCN0000286892 GAATGGAGACTTGGAACGGAT pLKO_005 261 CDS 100% 2.640 1.848 N ESS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005261282.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01872 pDONR223 100% 99.7% 99.7% None 400_402delGCA n/a
2 ccsbBroad304_01872 pLX_304 0% 99.7% 99.7% V5 400_402delGCA n/a
3 TRCN0000479383 ACCGCCCAAGATGCCGCATAAGAC pLX_317 12.5% 99.7% 99.7% V5 400_402delGCA n/a
Download CSV