Transcript: Human XM_005261525.4

PREDICTED: Homo sapiens ADP ribosylation factor GTPase activating protein 3 (ARFGAP3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARFGAP3 (26286)
Length:
2590
CDS:
113..1531

Additional Resources:

NCBI RefSeq record:
XM_005261525.4
NBCI Gene record:
ARFGAP3 (26286)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005261525.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047337 GCCAAGGTGGTATCTAAAGAA pLKO.1 896 CDS 100% 5.625 4.500 N ARFGAP3 n/a
2 TRCN0000307677 GCCAAGGTGGTATCTAAAGAA pLKO_005 896 CDS 100% 5.625 4.500 N ARFGAP3 n/a
3 TRCN0000047333 GCCCACTAACAAGGTGTGTTT pLKO.1 169 CDS 100% 4.950 3.960 N ARFGAP3 n/a
4 TRCN0000047336 GCACTGATCTGTGGCTTGATA pLKO.1 498 CDS 100% 5.625 3.938 N ARFGAP3 n/a
5 TRCN0000291341 GCACTGATCTGTGGCTTGATA pLKO_005 498 CDS 100% 5.625 3.938 N ARFGAP3 n/a
6 TRCN0000047334 CCAGATTATGAGCCAGTTGAA pLKO.1 1196 CDS 100% 4.950 3.465 N ARFGAP3 n/a
7 TRCN0000291342 CCAGATTATGAGCCAGTTGAA pLKO_005 1196 CDS 100% 4.950 3.465 N ARFGAP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005261525.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08012 pDONR223 100% 91.3% 91.4% None 1062_1063ins132;1221G>A;1299T>C n/a
2 ccsbBroad304_08012 pLX_304 0% 91.3% 91.4% V5 1062_1063ins132;1221G>A;1299T>C n/a
3 TRCN0000472685 AGATATCTTATCCCTGGCAACTAA pLX_317 20.7% 91.3% 91.4% V5 1062_1063ins132;1221G>A;1299T>C n/a
Download CSV