Transcript: Human XM_005261783.2

PREDICTED: Homo sapiens chromosome 22 open reading frame 23 (C22orf23), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
C22orf23 (84645)
Length:
1588
CDS:
174..794

Additional Resources:

NCBI RefSeq record:
XM_005261783.2
NBCI Gene record:
C22orf23 (84645)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005261783.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420875 CAATGATTAACTGGCCAATAA pLKO_005 1340 3UTR 100% 13.200 18.480 N C22orf23 n/a
2 TRCN0000432476 CATATTTAACGTGGGTCATTA pLKO_005 1363 3UTR 100% 13.200 18.480 N C22orf23 n/a
3 TRCN0000423309 CCTGAGCTAGACCGATTTGAA pLKO_005 567 CDS 100% 5.625 4.500 N C22orf23 n/a
4 TRCN0000127554 CGAGGAATCATCCTTGCTGAA pLKO.1 663 CDS 100% 4.050 2.835 N C22orf23 n/a
5 TRCN0000128071 GAGGAACTTAGGAAGGGTCTT pLKO.1 902 3UTR 100% 4.050 2.835 N C22orf23 n/a
6 TRCN0000127553 CCAGAGAGTCTTACCTTCCAA pLKO.1 317 CDS 100% 3.000 2.100 N C22orf23 n/a
7 TRCN0000130646 CCTTGCTGAAATCTCCCAGAA pLKO.1 674 CDS 100% 4.050 2.835 N C22orf23 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005261783.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09211 pDONR223 100% 81.8% 77.5% None (many diffs) n/a
2 ccsbBroad304_09211 pLX_304 0% 81.8% 77.5% V5 (many diffs) n/a
3 TRCN0000491754 GCGCTTTCTGTACGAGCATTCTAC pLX_317 56.9% 81.8% 77.5% V5 (many diffs) n/a
Download CSV