Transcript: Human XM_005262090.1

PREDICTED: Homo sapiens angiomotin (AMOT), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AMOT (154796)
Length:
6187
CDS:
470..2497

Additional Resources:

NCBI RefSeq record:
XM_005262090.1
NBCI Gene record:
AMOT (154796)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005262090.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160957 GAAGCAAGTGTACGTTGACAA pLKO.1 1027 CDS 100% 4.950 6.930 N AMOT n/a
2 TRCN0000166812 CGACACATCGAAATCCGAGAT pLKO.1 950 CDS 100% 4.050 5.670 N AMOT n/a
3 TRCN0000351617 CGACACATCGAAATCCGAGAT pLKO_005 950 CDS 100% 4.050 5.670 N AMOT n/a
4 TRCN0000162161 CTCTGGAAGCTGATATGACAA pLKO.1 1260 CDS 100% 4.950 3.465 N AMOT n/a
5 TRCN0000159177 GAAGAAATCTTGATGGCCAAT pLKO.1 1436 CDS 100% 4.050 2.835 N AMOT n/a
6 TRCN0000165373 GCAAGAGTTGGAAGGATGCTA pLKO.1 589 CDS 100% 3.000 2.100 N AMOT n/a
7 TRCN0000342987 GCAAGAGTTGGAAGGATGCTA pLKO_005 589 CDS 100% 3.000 2.100 N AMOT n/a
8 TRCN0000162010 GATGCAGAGATGGTGGAATAT pLKO.1 2468 CDS 100% 13.200 7.920 N AMOT n/a
9 TRCN0000342981 GATGCAGAGATGGTGGAATAT pLKO_005 2468 CDS 100% 13.200 7.920 N AMOT n/a
10 TRCN0000162009 GAGGAGAATGTGATGAGACAT pLKO.1 1301 CDS 100% 4.950 2.970 N AMOT n/a
11 TRCN0000343044 GAGGAGAATGTGATGAGACAT pLKO_005 1301 CDS 100% 4.950 2.970 N AMOT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005262090.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13295 pDONR223 100% 99.8% 99.8% None 1853_1854insTCC n/a
2 ccsbBroad304_13295 pLX_304 0% 99.8% 99.8% V5 1853_1854insTCC n/a
3 TRCN0000465916 CCATCAGTCGCCGTTGCAGCGCGC pLX_317 15.7% 99.8% 99.8% V5 1853_1854insTCC n/a
Download CSV