Transcript: Human XM_005262314.4

PREDICTED: Homo sapiens StAR related lipid transfer domain containing 8 (STARD8), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
STARD8 (9754)
Length:
4932
CDS:
189..3512

Additional Resources:

NCBI RefSeq record:
XM_005262314.4
NBCI Gene record:
STARD8 (9754)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005262314.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422374 ATGAGACCTCGCCTGACAATG pLKO_005 2308 CDS 100% 10.800 15.120 N STARD8 n/a
2 TRCN0000047902 CCGTTGGCATAGCTTCCAGAA pLKO.1 1922 CDS 100% 4.050 5.670 N STARD8 n/a
3 TRCN0000430332 GATCCAGAACCTGCGTCAAAT pLKO_005 2285 CDS 100% 13.200 9.240 N STARD8 n/a
4 TRCN0000431776 TGATCAGTGACTGCAAGAAAC pLKO_005 2746 CDS 100% 10.800 7.560 N STARD8 n/a
5 TRCN0000047901 GCTTCCTCAAGCACCTTGAAT pLKO.1 823 CDS 100% 5.625 3.938 N STARD8 n/a
6 TRCN0000047899 GACTGGTACAACAAAGTCTTT pLKO.1 3408 CDS 100% 4.950 3.465 N STARD8 n/a
7 TRCN0000047900 GCTCTACTTCTTAAGTGACAT pLKO.1 2534 CDS 100% 4.950 3.465 N STARD8 n/a
8 TRCN0000047898 GCTGACCTGCTAAAGCAGTAT pLKO.1 2361 CDS 100% 4.950 3.465 N STARD8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005262314.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02235 pDONR223 100% 92.4% 92.4% None 1_240del;295_306del n/a
2 ccsbBroad304_02235 pLX_304 0% 92.4% 92.4% V5 1_240del;295_306del n/a
3 TRCN0000466173 AGTTAAATACTTTACTAGTAGTTC pLX_317 11.6% 92.4% 92.4% V5 1_240del;295_306del n/a
Download CSV