Transcript: Human XM_005262359.4

PREDICTED: Homo sapiens stromal antigen 2 (STAG2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
STAG2 (10735)
Length:
5923
CDS:
215..4021

Additional Resources:

NCBI RefSeq record:
XM_005262359.4
NBCI Gene record:
STAG2 (10735)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005262359.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000153782 CCACTGATGTCTTACCGAAAT pLKO.1 3332 CDS 100% 10.800 15.120 N STAG2 n/a
2 TRCN0000342678 CCACTGATGTCTTACCGAAAT pLKO_005 3332 CDS 100% 10.800 15.120 N STAG2 n/a
3 TRCN0000150541 GCTTATGCTTACCAAGATCAA pLKO.1 4139 3UTR 100% 4.950 6.930 N STAG2 n/a
4 TRCN0000152009 CACTATGTAATCCTTTGGCAA pLKO.1 2426 CDS 100% 2.640 3.696 N STAG2 n/a
5 TRCN0000152523 GCAAGCAGTCTTCAGGTTAAA pLKO.1 5110 3UTR 100% 13.200 10.560 N STAG2 n/a
6 TRCN0000342744 GCAAGCAGTCTTCAGGTTAAA pLKO_005 5110 3UTR 100% 13.200 10.560 N STAG2 n/a
7 TRCN0000153201 CCTCTGCTGGATTTCTGTTTA pLKO.1 4404 3UTR 100% 13.200 9.240 N STAG2 n/a
8 TRCN0000151761 CCTCTACATTTAGTGGCATAA pLKO.1 3039 CDS 100% 10.800 7.560 N STAG2 n/a
9 TRCN0000151938 CCAACGTGAATACTACTGTTA pLKO.1 2544 CDS 100% 4.950 3.465 N STAG2 n/a
10 TRCN0000153118 GAGAGGAAGCACTAACAGATA pLKO.1 1740 CDS 100% 4.950 3.465 N STAG2 n/a
11 TRCN0000342677 GAGAGGAAGCACTAACAGATA pLKO_005 1740 CDS 100% 4.950 3.465 N STAG2 n/a
12 TRCN0000154078 CCAAACCGAATGAATGGTCAT pLKO.1 413 CDS 100% 4.050 2.835 N STAG2 n/a
13 TRCN0000151221 GCAGTTCTTACAGCTTTGTTT pLKO.1 5768 3UTR 100% 5.625 3.375 N STAG2 n/a
14 TRCN0000342745 GCAGTTCTTACAGCTTTGTTT pLKO_005 5768 3UTR 100% 5.625 3.375 N STAG2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005262359.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02516 pDONR223 100% 97% 97% None 3468_3578del n/a
2 ccsbBroad304_02516 pLX_304 0% 97% 97% V5 3468_3578del n/a
3 TRCN0000478924 CAATCAGTGATTTGGTCCAAAAAA pLX_317 10.2% 97% 97% V5 3468_3578del n/a
Download CSV