Transcript: Human XM_005262368.4

PREDICTED: Homo sapiens dedicator of cytokinesis 11 (DOCK11), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DOCK11 (139818)
Length:
6915
CDS:
309..6569

Additional Resources:

NCBI RefSeq record:
XM_005262368.4
NBCI Gene record:
DOCK11 (139818)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005262368.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265580 ACTAAATGAGCGGCTAATTAA pLKO_005 6344 CDS 100% 15.000 21.000 N Dock11 n/a
2 TRCN0000369611 ACTAAATGAGCGGCTAATTAA pLKO_005 6344 CDS 100% 15.000 21.000 N DOCK11 n/a
3 TRCN0000364808 GGCAATGTAACGTGGATATTA pLKO_005 2692 CDS 100% 15.000 21.000 N DOCK11 n/a
4 TRCN0000376430 TGATGGCCATAACCCATTAAT pLKO_005 4625 CDS 100% 15.000 21.000 N DOCK11 n/a
5 TRCN0000369589 CCAACAGGGTGCTTACATATT pLKO_005 6698 3UTR 100% 13.200 18.480 N DOCK11 n/a
6 TRCN0000123018 GCTACATACAACAGGGAATTT pLKO.1 1684 CDS 100% 13.200 18.480 N DOCK11 n/a
7 TRCN0000369590 GTACTAGACACCATATCATTT pLKO_005 4569 CDS 100% 13.200 10.560 N DOCK11 n/a
8 TRCN0000135095 CGAGAACATCATGGCAAGTTT pLKO.1 1208 CDS 100% 5.625 4.500 N DOCK11 n/a
9 TRCN0000364869 AGGAATTGAACCTGATATAAA pLKO_005 1358 CDS 100% 15.000 10.500 N DOCK11 n/a
10 TRCN0000123015 CCACTTAGAATCTACCATTTA pLKO.1 2753 CDS 100% 13.200 9.240 N DOCK11 n/a
11 TRCN0000135623 GCTTTACTTCACCTGCCAATA pLKO.1 3961 CDS 100% 10.800 7.560 N DOCK11 n/a
12 TRCN0000123017 GCGATGTGTTATGTCCATGTA pLKO.1 5262 CDS 100% 4.950 3.465 N DOCK11 n/a
13 TRCN0000123014 CGTGACAATGAGACTGACCTT pLKO.1 6585 3UTR 100% 2.640 1.848 N DOCK11 n/a
14 TRCN0000123016 CCAGGCTACTTGAATCTGAAT pLKO.1 2655 CDS 100% 4.950 2.970 N DOCK11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005262368.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.