Transcript: Human XM_005262935.4

PREDICTED: Homo sapiens cytochrome P450 family 4 subfamily V member 2 (CYP4V2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CYP4V2 (285440)
Length:
4436
CDS:
40..1614

Additional Resources:

NCBI RefSeq record:
XM_005262935.4
NBCI Gene record:
CYP4V2 (285440)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005262935.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152588 GCAGATCATTGAGTACACAGA pLKO.1 264 CDS 100% 2.640 3.696 N CYP4V2 n/a
2 TRCN0000156694 GCACAGAGATCCGAGATACTT pLKO.1 1314 CDS 100% 5.625 3.938 N CYP4V2 n/a
3 TRCN0000151148 GATCAAGTTGAAGAGGAGAAA pLKO.1 1578 CDS 100% 4.950 3.465 N CYP4V2 n/a
4 TRCN0000153056 GCCTAGGACTTCTTACAAGTA pLKO.1 434 CDS 100% 4.950 3.465 N CYP4V2 n/a
5 TRCN0000150663 GAAAGATGTTAACACCCACTT pLKO.1 479 CDS 100% 4.050 2.835 N CYP4V2 n/a
6 TRCN0000152518 GCCAATGAAATGAACGCCAAT pLKO.1 856 CDS 100% 4.050 2.835 N CYP4V2 n/a
7 TRCN0000157855 CCGTCATCATTCCCTATGCAT pLKO.1 1292 CDS 100% 3.000 2.100 N CYP4V2 n/a
8 TRCN0000153430 GACAGTTGATTCTTCGTCCAA pLKO.1 1544 CDS 100% 2.640 1.848 N CYP4V2 n/a
9 TRCN0000151500 CATTGAGTACACAGAGGAATA pLKO.1 270 CDS 100% 10.800 6.480 N CYP4V2 n/a
10 TRCN0000156666 GCTTTGGCTTGATCTCTGGTA pLKO.1 753 CDS 100% 2.640 1.584 N CYP4V2 n/a
11 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 1959 3UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
12 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2639 3UTR 100% 4.950 2.475 Y KAAG1 n/a
13 TRCN0000130146 CAGGTTCAAGTGATTCTCCTA pLKO.1 2379 3UTR 100% 2.640 1.320 Y DICER1-AS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005262935.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09980 pDONR223 100% 99.6% 99.6% None 775C>A;810T>G;1224_1225insGCA n/a
2 ccsbBroad304_09980 pLX_304 0% 99.6% 99.6% V5 775C>A;810T>G;1224_1225insGCA n/a
3 TRCN0000478667 GGAATCTGCACGCAGGCCGTTCTC pLX_317 25.5% 99.6% 99.6% V5 775C>A;810T>G;1224_1225insGCA n/a
Download CSV