Transcript: Human XM_005263062.2

PREDICTED: Homo sapiens polypeptide N-acetylgalactosaminyltransferase 7 (GALNT7), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GALNT7 (51809)
Length:
4291
CDS:
68..2041

Additional Resources:

NCBI RefSeq record:
XM_005263062.2
NBCI Gene record:
GALNT7 (51809)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005263062.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035544 CGCCCATTTATGTTGGGTCTT pLKO.1 1422 CDS 100% 4.050 5.670 N GALNT7 n/a
2 TRCN0000290700 CGCCCATTTATGTTGGGTCTT pLKO_005 1422 CDS 100% 4.050 5.670 N GALNT7 n/a
3 TRCN0000375708 AGTGGACTTAGAGTCTATTAG pLKO_005 304 CDS 100% 13.200 9.240 N Galnt7 n/a
4 TRCN0000296683 ATGGCCTAGTGAAGGTATTTC pLKO_005 864 CDS 100% 13.200 9.240 N GALNT7 n/a
5 TRCN0000035547 CCTGCACAGATTTACTCATAT pLKO.1 1906 CDS 100% 13.200 9.240 N GALNT7 n/a
6 TRCN0000296744 CTGAAACCTGCTGCAACTATT pLKO_005 2106 3UTR 100% 13.200 9.240 N GALNT7 n/a
7 TRCN0000375709 GCCAAGAAGAATGCAAGTATT pLKO_005 645 CDS 100% 13.200 9.240 N Galnt7 n/a
8 TRCN0000035548 GCAAATCAACTCATGCAGTAT pLKO.1 1793 CDS 100% 4.950 3.465 N GALNT7 n/a
9 TRCN0000290699 GCAAATCAACTCATGCAGTAT pLKO_005 1793 CDS 100% 4.950 3.465 N GALNT7 n/a
10 TRCN0000035546 CCTCAGACATTCACCTACCAT pLKO.1 416 CDS 100% 3.000 2.100 N GALNT7 n/a
11 TRCN0000110285 GCCTCTTTCATTTCTCAGTAT pLKO.1 2582 3UTR 100% 4.950 2.970 N Galnt7 n/a
12 TRCN0000335093 GCCTCTTTCATTTCTCAGTAT pLKO_005 2582 3UTR 100% 4.950 2.970 N Galnt7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005263062.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08347 pDONR223 100% 97% 97.5% None (many diffs) n/a
2 ccsbBroad304_08347 pLX_304 0% 97% 97.5% V5 (many diffs) n/a
3 TRCN0000479173 CCGATACATACGAAAACCTTCCGG pLX_317 17.2% 97% 97.5% V5 (many diffs) n/a
Download CSV