Transcript: Human XM_005264113.2

PREDICTED: Homo sapiens inner membrane mitochondrial protein (IMMT), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IMMT (10989)
Length:
2598
CDS:
82..2262

Additional Resources:

NCBI RefSeq record:
XM_005264113.2
NBCI Gene record:
IMMT (10989)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005264113.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125630 CCCGTTTCTATGCTGTTCAAA pLKO.1 1883 CDS 100% 5.625 7.875 N Immt n/a
2 TRCN0000323849 CCCGTTTCTATGCTGTTCAAA pLKO_005 1883 CDS 100% 5.625 7.875 N Immt n/a
3 TRCN0000136189 GCTAAGGTTGTATCTCAGTAT pLKO.1 1039 CDS 100% 4.950 6.930 N IMMT n/a
4 TRCN0000135616 GTCTAGAAATGAGCAGGTTTA pLKO.1 2352 3UTR 100% 10.800 8.640 N IMMT n/a
5 TRCN0000136244 GCACTATCCTATATGCCAAAT pLKO.1 260 CDS 100% 10.800 7.560 N IMMT n/a
6 TRCN0000137588 CCAAGCTTTAACCGCAGCTAT pLKO.1 1812 CDS 100% 4.950 3.465 N IMMT n/a
7 TRCN0000135198 CAGAAATAGCTTGTACCAGTA pLKO.1 1938 CDS 100% 4.050 2.835 N IMMT n/a
8 TRCN0000135307 CAAAGGAAATCAGCAGTGATA pLKO.1 2299 3UTR 100% 4.950 2.970 N IMMT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005264113.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07719 pDONR223 100% 95.6% 95.5% None (many diffs) n/a
2 ccsbBroad304_07719 pLX_304 0% 95.6% 95.5% V5 (many diffs) n/a
3 TRCN0000470375 CCTGTACGACGGTCTCAATCCCGC pLX_317 21.6% 95.6% 95.5% V5 (many diffs) n/a
Download CSV