Transcript: Human XM_005264134.3

PREDICTED: Homo sapiens chromosome 2 open reading frame 73 (C2orf73), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
C2orf73 (129852)
Length:
951
CDS:
281..781

Additional Resources:

NCBI RefSeq record:
XM_005264134.3
NBCI Gene record:
C2orf73 (129852)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005264134.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142692 CAGGAGCTGTTAGAGCCTAAA pLKO.1 602 CDS 100% 10.800 8.640 N C2orf73 n/a
2 TRCN0000121716 CCCTGGAATATAGGGAAATTT pLKO.1 809 3UTR 100% 15.000 10.500 N C2orf73 n/a
3 TRCN0000121994 GTACATCAGCAGAACTTCAAA pLKO.1 324 CDS 100% 5.625 3.938 N C2orf73 n/a
4 TRCN0000141292 CAGTAGGCCAACAGTTCCTAA pLKO.1 460 CDS 100% 4.950 3.465 N C2orf73 n/a
5 TRCN0000143273 GCAGAGGTATTACTGAACACT pLKO.1 485 CDS 100% 3.000 2.100 N C2orf73 n/a
6 TRCN0000122789 GAGAAAGGAAACTCAGCGGAA pLKO.1 542 CDS 100% 2.160 1.512 N C2orf73 n/a
7 TRCN0000141127 CAGAATGATCTCACCAGGTCT pLKO.1 565 CDS 100% 2.640 1.584 N C2orf73 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005264134.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16088 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_16088 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477040 GTTCTACAGAGAGAGTCCCCCCTT pLX_317 74.2% 100% 100% V5 n/a
4 ccsbBroadEn_16089 pDONR223 0% 99.7% 99.3% None 398C>T n/a
5 ccsbBroad304_16089 pLX_304 0% 99.7% 99.3% V5 398C>T n/a
6 TRCN0000475860 TCCTATCATTGCAAGGAATCCGTG pLX_317 74.2% 99.7% 99.3% V5 398C>T n/a
7 ccsbBroadEn_13149 pDONR223 100% 99.5% 98.7% None 398C>T;461G>C n/a
8 ccsbBroad304_13149 pLX_304 0% 99.5% 98.7% V5 398C>T;461G>C n/a
9 TRCN0000467194 CAGAGTACTCCGAGACTACAGGTC pLX_317 59.8% 99.5% 98.7% V5 398C>T;461G>C n/a
Download CSV