Transcript: Human XM_005264317.3

PREDICTED: Homo sapiens latent transforming growth factor beta binding protein 1 (LTBP1), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LTBP1 (4052)
Length:
5996
CDS:
26..5032

Additional Resources:

NCBI RefSeq record:
XM_005264317.3
NBCI Gene record:
LTBP1 (4052)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005264317.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000310764 GATGACCTGTGTCGATGTAAA pLKO_005 4837 CDS 100% 13.200 18.480 N LTBP1 n/a
2 TRCN0000053376 CCGTTGAATACCGCCTTGAAT pLKO.1 4985 CDS 100% 5.625 7.875 N LTBP1 n/a
3 TRCN0000169135 CCGTTGAATACCGCCTTGAAT pLKO.1 4985 CDS 100% 5.625 7.875 N LTBP1 n/a
4 TRCN0000204875 CCGTTGAATACCGCCTTGAAT pLKO.1 4985 CDS 100% 5.625 7.875 N LTBP1 n/a
5 TRCN0000299667 CCGTTGAATACCGCCTTGAAT pLKO_005 4985 CDS 100% 5.625 7.875 N LTBP1 n/a
6 TRCN0000053375 CCGGATGGATTTCAGCTAGAT pLKO.1 3431 CDS 100% 4.950 6.930 N LTBP1 n/a
7 TRCN0000299668 CCGGATGGATTTCAGCTAGAT pLKO_005 3431 CDS 100% 4.950 6.930 N LTBP1 n/a
8 TRCN0000303819 GGTGGAACAGTGCTGTTATTT pLKO_005 5281 3UTR 100% 15.000 10.500 N LTBP1 n/a
9 TRCN0000065584 CCCTCCAAATTTCACAGGAAA pLKO.1 1288 CDS 100% 4.950 3.465 N Ltbp1 n/a
10 TRCN0000053373 CCGTCCAGATACATCAGGTTT pLKO.1 1506 CDS 100% 4.950 3.465 N LTBP1 n/a
11 TRCN0000053377 CCTGTTGAAGTAGCTCCTGAA pLKO.1 2414 CDS 100% 4.050 2.835 N LTBP1 n/a
12 TRCN0000310509 CCTGTTGAAGTAGCTCCTGAA pLKO_005 2414 CDS 100% 4.050 2.835 N LTBP1 n/a
13 TRCN0000053374 GCATCCTCAATGGATGTGAAA pLKO.1 4743 CDS 100% 0.495 0.347 N LTBP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005264317.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13894 pDONR223 100% 77.2% 33.5% None (many diffs) n/a
2 ccsbBroad304_13894 pLX_304 0% 77.2% 33.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV