Transcript: Human XM_005264348.4

PREDICTED: Homo sapiens WD repeat containing planar cell polarity effector (WDPCP), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WDPCP (51057)
Length:
3907
CDS:
463..2808

Additional Resources:

NCBI RefSeq record:
XM_005264348.4
NBCI Gene record:
WDPCP (51057)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005264348.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416160 TATGAATGCATTCGGAATAAA pLKO_005 1417 CDS 100% 15.000 12.000 N WDPCP n/a
2 TRCN0000167494 GATATTCATTACCTTGCACTA pLKO.1 2275 CDS 100% 4.050 3.240 N WDPCP n/a
3 TRCN0000168387 GCTGTGAAGATTCTTCGCTAA pLKO.1 1526 CDS 100% 4.050 3.240 N WDPCP n/a
4 TRCN0000422016 GACTCTGCAATTCAGTAAATT pLKO_005 1734 CDS 100% 15.000 10.500 N WDPCP n/a
5 TRCN0000412920 AGCAAAGTGATCGTAAGTAAA pLKO_005 2810 3UTR 100% 13.200 9.240 N WDPCP n/a
6 TRCN0000423686 CTCTCAGCCTTGGATTATAAG pLKO_005 1075 CDS 100% 13.200 9.240 N WDPCP n/a
7 TRCN0000167495 GATGGAGTCTTCTGATGTAAA pLKO.1 1038 CDS 100% 13.200 9.240 N WDPCP n/a
8 TRCN0000429215 GATAGCTCCTCAGGTTGTTTC pLKO_005 1791 CDS 100% 10.800 7.560 N WDPCP n/a
9 TRCN0000167102 CCATTGTAAACCATCTTCTTA pLKO.1 2039 CDS 100% 5.625 3.938 N WDPCP n/a
10 TRCN0000431726 TTCACTGTGATGAGATCTATG pLKO_005 1949 CDS 100% 10.800 6.480 N WDPCP n/a
11 TRCN0000417153 TTGGAATATAGAGATCAAATC pLKO_005 2152 CDS 100% 10.800 6.480 N WDPCP n/a
12 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3815 3UTR 100% 4.950 2.475 Y ERAP2 n/a
13 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3816 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005264348.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08204 pDONR223 100% 68.9% 68.1% None (many diffs) n/a
2 ccsbBroad304_08204 pLX_304 0% 68.9% 68.1% V5 (many diffs) n/a
3 TRCN0000477233 CAATCACCAACCCTTCTCCACCTG pLX_317 19.2% 68.9% 68.1% V5 (many diffs) n/a
Download CSV