Transcript: Human XM_005264985.1

PREDICTED: Homo sapiens raftlin, lipid raft linker 1 (RFTN1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RFTN1 (23180)
Length:
2959
CDS:
240..1976

Additional Resources:

NCBI RefSeq record:
XM_005264985.1
NBCI Gene record:
RFTN1 (23180)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005264985.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127814 GAGCTTGGTACGGTTGAAGAA pLKO.1 1950 CDS 100% 4.950 6.930 N RFTN1 n/a
2 TRCN0000128842 GCCTGAAATTCGTTGGTGTTA pLKO.1 703 CDS 100% 4.950 6.930 N RFTN1 n/a
3 TRCN0000130387 GCGATTCTCCAGAGAAGAAAT pLKO.1 1580 CDS 100% 13.200 9.240 N RFTN1 n/a
4 TRCN0000130134 CGACTCTTCTGCTTTGACAAA pLKO.1 2472 3UTR 100% 4.950 3.465 N RFTN1 n/a
5 TRCN0000129924 GACAAACAACAAGCAGAAGAA pLKO.1 1647 CDS 100% 4.950 3.465 N RFTN1 n/a
6 TRCN0000127713 GAGTGTATCCACCAAGCAGAT pLKO.1 1496 CDS 100% 4.050 2.835 N RFTN1 n/a
7 TRCN0000130852 GCAATACTACCCTGTCACCAT pLKO.1 1118 CDS 100% 2.640 1.848 N RFTN1 n/a
8 TRCN0000215938 CAGATGGAGTATTCATCTTTG pLKO.1 1288 CDS 100% 1.080 0.756 N Rftn1 n/a
9 TRCN0000130642 CCAGAAACTCATCCCAGAGTT pLKO.1 650 CDS 100% 0.495 0.347 N RFTN1 n/a
10 TRCN0000177755 CCCAGAGTTCATTAAGAAGGT pLKO.1 662 CDS 100% 2.640 1.584 N Rftn1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005264985.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02729 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02729 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474132 AATAATAGACAAATGTTTAACCGG pLX_317 29.3% 100% 100% V5 n/a
Download CSV