Transcript: Human XM_005265001.3

PREDICTED: Homo sapiens kelch like family member 18 (KLHL18), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KLHL18 (23276)
Length:
4656
CDS:
27..1781

Additional Resources:

NCBI RefSeq record:
XM_005265001.3
NBCI Gene record:
KLHL18 (23276)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005265001.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000446347 AGCAGCCTCGATCCCGTATTT pLKO_005 194 CDS 100% 13.200 18.480 N KLHL18 n/a
2 TRCN0000442944 TGACCTCGATGAGCTCGAATC pLKO_005 1294 CDS 100% 6.000 8.400 N KLHL18 n/a
3 TRCN0000157131 GCTGGACTTATCTACGCTGTA pLKO.1 885 CDS 100% 4.050 5.670 N KLHL18 n/a
4 TRCN0000438321 TGGTGCGTTGCTGCCACAAAT pLKO_005 763 CDS 100% 13.200 9.240 N KLHL18 n/a
5 TRCN0000157997 CATCCATCGCTGGACTTATCT pLKO.1 877 CDS 100% 5.625 3.938 N KLHL18 n/a
6 TRCN0000150654 GATGAGCTGAATGTCAAATCT pLKO.1 597 CDS 100% 5.625 3.938 N KLHL18 n/a
7 TRCN0000430114 CTGATCAACTTTGCCTACAAC pLKO_005 300 CDS 100% 4.950 3.465 N KLHL18 n/a
8 TRCN0000157613 GCAGGTCTTTGAAGCTGCATT pLKO.1 623 CDS 100% 4.950 3.465 N KLHL18 n/a
9 TRCN0000156496 CAAATCTGAGGAGCAGGTCTT pLKO.1 611 CDS 100% 4.050 2.835 N KLHL18 n/a
10 TRCN0000152669 GAGCATGAATAGCAAGAGAAG pLKO.1 1142 CDS 100% 4.050 2.835 N KLHL18 n/a
11 TRCN0000426646 CAGTCTTTGAGGGCAGGATAT pLKO_005 1333 CDS 100% 10.800 6.480 N KLHL18 n/a
12 TRCN0000154036 CCAGTTCCTTTCAGACAGAAT pLKO.1 728 CDS 100% 4.950 3.465 N KLHL18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005265001.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11712 pDONR223 100% 87.1% 87.1% None 1_195del;895_909del;1135_1149del n/a
2 ccsbBroad304_11712 pLX_304 0% 87.1% 87.1% V5 1_195del;895_909del;1135_1149del n/a
3 TRCN0000472472 TACTATGTGATGTCTAAATTAGGG pLX_317 33.4% 87.1% 87.1% V5 1_195del;895_909del;1135_1149del n/a
Download CSV