Transcript: Human XM_005265533.1

PREDICTED: Homo sapiens SEC22 homolog C, vesicle trafficking protein (SEC22C), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SEC22C (9117)
Length:
6575
CDS:
595..1296

Additional Resources:

NCBI RefSeq record:
XM_005265533.1
NBCI Gene record:
SEC22C (9117)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005265533.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059551 GTTCCTTTCGTAGCCTGCATT pLKO.1 1069 CDS 100% 4.950 6.930 N SEC22C n/a
2 TRCN0000232845 CTTGGAGCCTGCTCCTAATTT pLKO_005 900 CDS 100% 15.000 10.500 N SEC22C n/a
3 TRCN0000232846 CACCTTGCAGAACATTCTTTA pLKO_005 1006 CDS 100% 13.200 9.240 N SEC22C n/a
4 TRCN0000232844 CCTCTCAGCCTCTACTGATTT pLKO_005 219 5UTR 100% 13.200 9.240 N SEC22C n/a
5 TRCN0000059550 GAAGGTTGTGACTTTAGTATA pLKO.1 328 5UTR 100% 13.200 9.240 N SEC22C n/a
6 TRCN0000257084 GAAGGTTGTGACTTTAGTATA pLKO_005 328 5UTR 100% 13.200 9.240 N SEC22C n/a
7 TRCN0000232847 GTGTTATTTCATGAATCATTC pLKO_005 6231 3UTR 100% 10.800 7.560 N SEC22C n/a
8 TRCN0000059552 GAGTTCACCTTGCAGAACATT pLKO.1 1001 CDS 100% 5.625 3.938 N SEC22C n/a
9 TRCN0000059549 CTATGTAAGTTCCTCTCAGAT pLKO.1 765 CDS 100% 4.950 3.465 N SEC22C n/a
10 TRCN0000059548 GCTCCTAATTTCCGAATGGAA pLKO.1 910 CDS 100% 3.000 2.100 N SEC22C n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3058 3UTR 100% 13.200 6.600 Y LIAS n/a
12 TRCN0000165205 GCCTCAGTTTCCTCATCTGTA pLKO.1 5540 3UTR 100% 4.950 2.475 Y YIF1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005265533.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02084 pDONR223 100% 76.8% 76.8% None 0_1ins210 n/a
2 ccsbBroad304_02084 pLX_304 0% 76.8% 76.8% V5 0_1ins210 n/a
3 TRCN0000474636 ACGCTGGGGCCGTCCTATTACCTT pLX_317 56.5% 76.8% 32.6% V5 (not translated due to prior stop codon) 0_1ins210;276_277insG n/a
4 ccsbBroadEn_02085 pDONR223 100% 58.3% 54.6% None (many diffs) n/a
5 ccsbBroad304_02085 pLX_304 0% 58.3% 54.6% V5 (many diffs) n/a
6 TRCN0000470422 CATTGTTCCGCTCTCCCCGGGCCA pLX_317 59.4% 58.3% 54.6% V5 (many diffs) n/a
Download CSV