Transcript: Human XM_005265708.3

PREDICTED: Homo sapiens YTH domain containing 1 (YTHDC1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
YTHDC1 (91746)
Length:
3271
CDS:
338..2491

Additional Resources:

NCBI RefSeq record:
XM_005265708.3
NBCI Gene record:
YTHDC1 (91746)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005265708.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147357 GCAGTATCATAAGAACTGGAA pLKO.1 2644 3UTR 100% 2.640 3.696 N YTHDC1 n/a
2 TRCN0000243990 GCGAGATAGAGGACGTGATAG pLKO_005 2401 CDS 100% 10.800 8.640 N YTHDC1 n/a
3 TRCN0000243988 CACCAGAGACCAGGGTATTTA pLKO_005 1955 CDS 100% 15.000 10.500 N YTHDC1 n/a
4 TRCN0000243989 TGCCTCCAGAGAACCTTATAA pLKO_005 697 CDS 100% 15.000 10.500 N YTHDC1 n/a
5 TRCN0000243987 TGGATTTGCAGGCGTGAATTA pLKO_005 1622 CDS 100% 13.200 9.240 N YTHDC1 n/a
6 TRCN0000246498 TGGATTTGCAGGCGTGAATTA pLKO_005 1622 CDS 100% 13.200 9.240 N Ythdc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005265708.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04559 pDONR223 100% 96.4% 96.4% None 198T>A;971_972ins54;1664_1687del n/a
2 ccsbBroad304_04559 pLX_304 0% 96.4% 96.4% V5 198T>A;971_972ins54;1664_1687del n/a
3 TRCN0000465965 CTGTAATCCTACAAACCTTTAATC pLX_317 13.3% 96.4% 96.4% V5 198T>A;971_972ins54;1664_1687del n/a
Download CSV