Transcript: Human XM_005265819.2

PREDICTED: Homo sapiens adrenoceptor alpha 1B (ADRA1B), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADRA1B (147)
Length:
2167
CDS:
71..1057

Additional Resources:

NCBI RefSeq record:
XM_005265819.2
NBCI Gene record:
ADRA1B (147)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005265819.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000378178 GGATCCATTCCAAGAACTTTC pLKO_005 831 CDS 100% 10.800 15.120 N ADRA1B n/a
2 TRCN0000356610 GGGCATTGTGGTCGGTATGTT pLKO_005 958 CDS 100% 5.625 7.875 N ADRA1B n/a
3 TRCN0000008059 CGGTCATTCTAGTCATGTACT pLKO.1 720 CDS 100% 4.950 6.930 N ADRA1B n/a
4 TRCN0000008056 CCGTGTCTATATAGTGGCCAA pLKO.1 742 CDS 100% 2.160 3.024 N ADRA1B n/a
5 TRCN0000008058 GTCACCGAAGAACCCTTCTAT pLKO.1 659 CDS 100% 5.625 3.938 N ADRA1B n/a
6 TRCN0000008060 CCTGAGGATCCATTCCAAGAA pLKO.1 826 CDS 100% 4.950 3.465 N ADRA1B n/a
7 TRCN0000008057 CTACCCTTCTTCATCGCTCTA pLKO.1 992 CDS 100% 4.050 2.835 N ADRA1B n/a
8 TRCN0000356670 TCATGTACTGCCGTGTCTATA pLKO_005 732 CDS 100% 13.200 7.920 N ADRA1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005265819.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487719 CCAGTAACCCTTTATCGGCGTGAA pLX_317 17.8% 62.3% 61.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV