Transcript: Human XM_005265967.2

PREDICTED: Homo sapiens sarcoglycan delta (SGCD), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SGCD (6444)
Length:
683
CDS:
112..639

Additional Resources:

NCBI RefSeq record:
XM_005265967.2
NBCI Gene record:
SGCD (6444)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005265967.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118873 GCGGAAACGATGCCTGTATTT pLKO.1 201 CDS 100% 13.200 18.480 N SGCD n/a
2 TRCN0000296170 GCCGTAGAAGCTTATGGTAAA pLKO_005 502 CDS 100% 10.800 15.120 N SGCD n/a
3 TRCN0000098389 GAACTTCACAATTGATGGAAT pLKO.1 291 CDS 100% 4.950 6.930 N Sgcd n/a
4 TRCN0000308090 AGTGCTAACTCAGCTTATAAC pLKO_005 471 CDS 100% 13.200 10.560 N SGCD n/a
5 TRCN0000118876 CATCTGGATTCTCAAAGTCAT pLKO.1 270 CDS 100% 4.950 3.465 N SGCD n/a
6 TRCN0000118875 GAGCTGAAAGATTACGAGTTT pLKO.1 590 CDS 100% 4.950 3.465 N SGCD n/a
7 TRCN0000289129 GAGCTGAAAGATTACGAGTTT pLKO_005 590 CDS 100% 4.950 3.465 N SGCD n/a
8 TRCN0000098388 CCCGACCAGGTAATGCCCTAT pLKO.1 398 CDS 100% 1.350 1.890 N Sgcd n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005265967.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06941 pDONR223 100% 60.2% 57.6% None 84T>C;500_501ins73;525_526ins272 n/a
2 ccsbBroad304_06941 pLX_304 0% 60.2% 57.6% V5 84T>C;500_501ins73;525_526ins272 n/a
3 TRCN0000474344 CATTGCGAATTACTTGTACTAGAC pLX_317 54.8% 60.2% 57.6% V5 84T>C;500_501ins73;525_526ins272 n/a
Download CSV