Transcript: Human XM_005266073.4

PREDICTED: Homo sapiens glutamate ionotropic receptor NMDA type subunit 1 (GRIN1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GRIN1 (2902)
Length:
4507
CDS:
396..3275

Additional Resources:

NCBI RefSeq record:
XM_005266073.4
NBCI Gene record:
GRIN1 (2902)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005266073.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417869 ACAAGACGTGGGTTCGGTATC pLKO_005 2824 CDS 100% 6.000 8.400 N GRIN1 n/a
2 TRCN0000063368 CCTGACTATTCTGGTCAAGAA pLKO.1 2069 CDS 100% 4.950 6.930 N GRIN1 n/a
3 TRCN0000063370 GCAGTACCATCCCACTGATAT pLKO.1 3521 3UTR 100% 13.200 9.240 N GRIN1 n/a
4 TRCN0000425861 TGCAAGTGGGCATCTACAATG pLKO_005 1543 CDS 100% 10.800 7.560 N GRIN1 n/a
5 TRCN0000063369 CCCTAATGACAGGAAGATCAT pLKO.1 1577 CDS 100% 4.950 3.465 N GRIN1 n/a
6 TRCN0000063371 CGCCAACTACAGCATCATGAA pLKO.1 1502 CDS 100% 4.950 3.465 N GRIN1 n/a
7 TRCN0000063372 GTTTGAGATGATGCGTGTCTA pLKO.1 848 CDS 100% 4.950 3.465 N GRIN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005266073.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487776 ACGTTGCACTGGCGGACTCGCCTT pLX_317 11.2% 97.8% 97.8% V5 (not translated due to prior stop codon) 566_628del n/a
2 TRCN0000492101 CATCCTGCCAAACATTACTGGTCT pLX_317 7.9% 91.4% 89.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV