Transcript: Human XM_005266186.1

PREDICTED: Homo sapiens zinc finger protein 84 (ZNF84), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF84 (7637)
Length:
6933
CDS:
350..2566

Additional Resources:

NCBI RefSeq record:
XM_005266186.1
NBCI Gene record:
ZNF84 (7637)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005266186.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419014 GTGACTTAGATGGATTGATTT pLKO_005 738 CDS 100% 13.200 18.480 N ZNF84 n/a
2 TRCN0000015193 CCGATCATAATTCATAGAGTA pLKO.1 2709 3UTR 100% 4.950 6.930 N ZNF84 n/a
3 TRCN0000429952 ATCCTAGGAATACAGTTAATA pLKO_005 2560 CDS 100% 15.000 10.500 N ZNF84 n/a
4 TRCN0000418987 GAGAGGTCGAGTCTCATTAAT pLKO_005 1589 CDS 100% 15.000 10.500 N ZNF84 n/a
5 TRCN0000015195 GCAGAATCAGATGACTTTAAT pLKO.1 806 CDS 100% 15.000 10.500 N ZNF84 n/a
6 TRCN0000434764 GCGGGAAATGAGGCAATATTT pLKO_005 2906 3UTR 100% 15.000 10.500 N ZNF84 n/a
7 TRCN0000430597 GATAACCAAGACAAGCTTAAA pLKO_005 626 CDS 100% 13.200 9.240 N ZNF84 n/a
8 TRCN0000015197 CTTTGAGAAGTCAGAGCTTAT pLKO.1 1501 CDS 100% 10.800 7.560 N ZNF84 n/a
9 TRCN0000015194 GCAGGAAATCACAGCTCGTTA pLKO.1 1755 CDS 100% 4.950 3.465 N ZNF84 n/a
10 TRCN0000015196 CTCACAGAAGTCACAGCTCAT pLKO.1 2509 CDS 100% 4.050 2.835 N ZNF84 n/a
11 TRCN0000423085 ACTTCAGGAAATGCAATTATG pLKO_005 2605 3UTR 100% 13.200 7.920 N ZNF84 n/a
12 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 4894 3UTR 100% 4.050 2.025 Y P3H4 n/a
13 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 4894 3UTR 100% 4.050 2.025 Y ORAI2 n/a
14 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 4894 3UTR 100% 4.050 2.025 Y P3H4 n/a
15 TRCN0000284687 TACAGGAGAGAAACCTTATAA pLKO_005 1204 CDS 100% 15.000 7.500 Y Zfp984 n/a
16 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 4839 3UTR 100% 13.200 6.600 Y LIAS n/a
17 TRCN0000243782 TGGAGAGAAACCCTATGAATA pLKO_005 1543 CDS 100% 13.200 6.600 Y Zfp977 n/a
18 TRCN0000012945 GCAGTGAATGTGGGAAAGCTT pLKO.1 1899 CDS 100% 3.000 1.500 Y ZNF146 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005266186.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14880 pDONR223 57.1% 98.6% 98.5% None (many diffs) n/a
2 ccsbBroad304_14880 pLX_304 0% 98.6% 98.5% V5 (many diffs) n/a
Download CSV