Transcript: Human XM_005266560.2

PREDICTED: Homo sapiens tudor domain containing 3 (TDRD3), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TDRD3 (81550)
Length:
3130
CDS:
747..2897

Additional Resources:

NCBI RefSeq record:
XM_005266560.2
NBCI Gene record:
TDRD3 (81550)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005266560.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356049 AGACGAATAGGACCTATTAAG pLKO_005 2259 CDS 100% 13.200 18.480 N TDRD3 n/a
2 TRCN0000073297 CGTACTTCTTACAAGCAATAA pLKO.1 1430 CDS 100% 13.200 18.480 N TDRD3 n/a
3 TRCN0000367423 ACGAAGATCTGGGCCAATTAA pLKO_005 2342 CDS 100% 15.000 12.000 N TDRD3 n/a
4 TRCN0000367466 AGTAGCTGTGGTGGATATTAT pLKO_005 2949 3UTR 100% 15.000 10.500 N TDRD3 n/a
5 TRCN0000073294 GCAGTGGATTACCTAGAAATA pLKO.1 1792 CDS 100% 13.200 9.240 N TDRD3 n/a
6 TRCN0000222581 CGGGTATGACAGCAGTTGTTA pLKO.1 2494 CDS 100% 5.625 3.938 N TDRD3 n/a
7 TRCN0000073293 CCTTCCACTTTCTCTTCAGAA pLKO.1 2926 3UTR 100% 4.950 3.465 N TDRD3 n/a
8 TRCN0000073295 GCAGAGAACTTGATCGAAGAA pLKO.1 1063 CDS 100% 4.950 3.465 N TDRD3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005266560.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04235 pDONR223 100% 90.9% 85.8% None 1837_1988del;2106_2148del n/a
2 ccsbBroad304_04235 pLX_304 0% 90.9% 85.8% V5 1837_1988del;2106_2148del n/a
3 TRCN0000479596 AACCGTCCCGTTAGTCGCAACCCA pLX_317 16.6% 90.9% 85.8% V5 1837_1988del;2106_2148del n/a
Download CSV