Transcript: Human XM_005267152.5

PREDICTED: Homo sapiens protein phosphatase 1 regulatory inhibitor subunit 14C (PPP1R14C), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PPP1R14C (81706)
Length:
3470
CDS:
1572..1898

Additional Resources:

NCBI RefSeq record:
XM_005267152.5
NBCI Gene record:
PPP1R14C (81706)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005267152.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002660 CCAACAGAGGAATTTATCAAA pLKO.1 1815 CDS 100% 5.625 4.500 N PPP1R14C n/a
2 TRCN0000356068 CAAACCAACAGAGGAATTTAT pLKO_005 1811 CDS 100% 15.000 10.500 N PPP1R14C n/a
3 TRCN0000356092 ATCTACACACAACTAAGTTAA pLKO_005 2332 3UTR 100% 13.200 9.240 N PPP1R14C n/a
4 TRCN0000356091 AGAGCTGCTTTCTCGGATAAG pLKO_005 1835 CDS 100% 10.800 7.560 N PPP1R14C n/a
5 TRCN0000367403 CTCTCCCAGAGACGAAGAAAG pLKO_005 1917 3UTR 100% 10.800 7.560 N PPP1R14C n/a
6 TRCN0000002657 CCTCTCAGTTACCAGCTCTTT pLKO.1 3104 3UTR 100% 4.950 3.465 N PPP1R14C n/a
7 TRCN0000002658 CGGATAAGAGGCATGAGGAAA pLKO.1 1848 CDS 100% 4.950 3.465 N PPP1R14C n/a
8 TRCN0000174806 GACATTGATGATCTTCTTGAT pLKO.1 1734 CDS 100% 4.950 3.465 N Ppp1r14c n/a
9 TRCN0000002659 GCTACAAACCAACAGAGGAAT pLKO.1 1807 CDS 100% 4.950 2.970 N PPP1R14C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005267152.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09083 pDONR223 100% 54.5% 44.8% None (many diffs) n/a
2 ccsbBroad304_09083 pLX_304 0% 54.5% 44.8% V5 (many diffs) n/a
3 TRCN0000474629 AAAGTTACACAATAAAACGGCTCA pLX_317 100% 54.5% 44.8% V5 (many diffs) n/a
Download CSV