Transcript: Human XM_005267416.4

PREDICTED: Homo sapiens apoptotic chromatin condensation inducer 1 (ACIN1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ACIN1 (22985)
Length:
4701
CDS:
128..4117

Additional Resources:

NCBI RefSeq record:
XM_005267416.4
NBCI Gene record:
ACIN1 (22985)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005267416.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238333 AGGATGAGACAGAGCGTAATG pLKO_005 2787 CDS 100% 10.800 15.120 N Acin1 n/a
2 TRCN0000359106 TACCACCTCCCTGGGTACTTA pLKO_005 4438 3UTR 100% 0.000 0.000 N ACIN1 n/a
3 TRCN0000359107 GGTCAGAGCAGATCGAAATTT pLKO_005 907 CDS 100% 15.000 10.500 N ACIN1 n/a
4 TRCN0000236236 AGCAAGATGAGCTGGATTATC pLKO_005 3354 CDS 100% 13.200 9.240 N ACIN1 n/a
5 TRCN0000236235 GCTGACACCAGGGAGCTATTA pLKO_005 1502 CDS 100% 13.200 9.240 N ACIN1 n/a
6 TRCN0000236233 TATCACCACTGAATCACTAAA pLKO_005 2722 CDS 100% 13.200 9.240 N ACIN1 n/a
7 TRCN0000359105 TCTGGATTGACAAGATCAAAT pLKO_005 3219 CDS 100% 13.200 9.240 N ACIN1 n/a
8 TRCN0000236234 ATCCCTACATACATACCAAAT pLKO_005 4231 3UTR 100% 10.800 7.560 N ACIN1 n/a
9 TRCN0000074690 GCACCAATCCTGAAAGAGTTT pLKO.1 1019 CDS 100% 4.950 3.465 N ACIN1 n/a
10 TRCN0000123423 CAAGATCAAATCTCATTGCTT pLKO.1 3229 CDS 100% 3.000 2.100 N Acin1 n/a
11 TRCN0000074691 CCTTTCACTTTAGGCCAGCTA pLKO.1 3155 CDS 100% 2.640 1.848 N ACIN1 n/a
12 TRCN0000074689 GCCCAAATCATTCAAGAGGAA pLKO.1 2575 CDS 100% 2.640 1.848 N ACIN1 n/a
13 TRCN0000074688 CCTCCCTCTCATTTCCCATTA pLKO.1 4319 3UTR 100% 10.800 6.480 N ACIN1 n/a
14 TRCN0000236237 GACTCGATCAGAGCGTGAATG pLKO_005 3565 CDS 100% 10.800 6.480 N ACIN1 n/a
15 TRCN0000074692 CTTTCACTTTAGGCCAGCTAA pLKO.1 3156 CDS 100% 4.950 2.970 N ACIN1 n/a
16 TRCN0000434193 AGGAGGAGGAAGAAGATGAAG pLKO_005 957 CDS 100% 4.950 2.475 Y Myt1 n/a
17 TRCN0000413041 AGGAAGAAGAGGAGGAGGAAG pLKO_005 939 CDS 100% 4.050 2.025 Y Myt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005267416.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.