Transcript: Human XM_005267759.2

PREDICTED: Homo sapiens SIX homeobox 4 (SIX4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SIX4 (51804)
Length:
3919
CDS:
64..2385

Additional Resources:

NCBI RefSeq record:
XM_005267759.2
NBCI Gene record:
SIX4 (51804)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005267759.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427223 AGTCCCTCTACACTACTAAAT pLKO_005 1906 CDS 100% 13.200 18.480 N SIX4 n/a
2 TRCN0000017161 CCCAGTGGAGTTATCCTTAAT pLKO.1 1156 CDS 100% 13.200 18.480 N SIX4 n/a
3 TRCN0000420112 GCCAGTATATATGCAACAAAT pLKO_005 1026 CDS 100% 13.200 10.560 N SIX4 n/a
4 TRCN0000428861 ATTACTGGTCAAGACCTATTG pLKO_005 2047 CDS 100% 10.800 8.640 N SIX4 n/a
5 TRCN0000017162 CCTCCTCATTAGTTAATGTAT pLKO.1 1862 CDS 100% 5.625 4.500 N SIX4 n/a
6 TRCN0000017160 CAAAGCAACAAGTAGCTTAAT pLKO.1 2232 CDS 100% 13.200 9.240 N SIX4 n/a
7 TRCN0000017159 CCTCAGCCTTTCCAGTCATAT pLKO.1 1002 CDS 100% 13.200 9.240 N SIX4 n/a
8 TRCN0000017158 CCAGTGCAAATTAACCAGTAT pLKO.1 1462 CDS 100% 4.950 3.465 N SIX4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005267759.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15076 pDONR223 96.5% 98.3% 98.3% None 1_39del n/a
2 ccsbBroad304_15076 pLX_304 0% 98.3% 98.3% V5 1_39del n/a
3 TRCN0000479146 GTGACTGGTTATGTCGCCGGACAT pLX_317 19.8% 98.3% 98.3% V5 1_39del n/a
Download CSV