Transcript: Human XM_005267817.4

PREDICTED: Homo sapiens exonuclease 3'-5' domain containing 2 (EXD2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EXD2 (55218)
Length:
4105
CDS:
88..1578

Additional Resources:

NCBI RefSeq record:
XM_005267817.4
NBCI Gene record:
EXD2 (55218)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005267817.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051631 CCAAGAACGTTATTGGATATT pLKO.1 157 CDS 100% 13.200 9.240 N EXD2 n/a
2 TRCN0000327893 CCAAGAACGTTATTGGATATT pLKO_005 157 CDS 100% 13.200 9.240 N EXD2 n/a
3 TRCN0000312684 GACTATTACTTGATGGTTAAA pLKO_005 940 CDS 100% 13.200 9.240 N EXD2 n/a
4 TRCN0000312741 GCAAGCTTCTGCAGGATTATG pLKO_005 230 CDS 100% 13.200 9.240 N EXD2 n/a
5 TRCN0000312677 TTGTCTAGTGCCTCGGTTTAT pLKO_005 1937 3UTR 100% 13.200 9.240 N EXD2 n/a
6 TRCN0000051630 CCAGATTTCAGTGGCTCTCTT pLKO.1 453 CDS 100% 4.950 3.465 N EXD2 n/a
7 TRCN0000051629 CCTCTTTATGATAACTGCTTT pLKO.1 769 CDS 100% 4.950 3.465 N EXD2 n/a
8 TRCN0000051628 GCCAAGAAATAAGAAGTCTAA pLKO.1 654 CDS 100% 4.950 3.465 N EXD2 n/a
9 TRCN0000051632 CGGAAGAACGTGATTCCACAT pLKO.1 1003 CDS 100% 4.050 2.835 N EXD2 n/a
10 TRCN0000327822 CGGAAGAACGTGATTCCACAT pLKO_005 1003 CDS 100% 4.050 2.835 N EXD2 n/a
11 TRCN0000216762 GTAATGGGCTTAGCCTGAAAT pLKO.1 317 CDS 100% 13.200 10.560 N Exd2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005267817.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03552 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03552 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473850 AGGAGTAGTTAGACATCTGCCGGA pLX_317 38.6% 100% 100% V5 n/a
Download CSV