Transcript: Human XM_005267864.3

PREDICTED: Homo sapiens presenilin 1 (PSEN1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PSEN1 (5663)
Length:
2788
CDS:
271..1674

Additional Resources:

NCBI RefSeq record:
XM_005267864.3
NBCI Gene record:
PSEN1 (5663)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005267864.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061742 CCAATTAGCATTCCATCAATT pLKO.1 1644 CDS 100% 13.200 18.480 N PSEN1 n/a
2 TRCN0000333365 CCAATTAGCATTCCATCAATT pLKO_005 1644 CDS 100% 13.200 18.480 N PSEN1 n/a
3 TRCN0000061740 CCTGTTTCGTAGCCATATTAA pLKO.1 1496 CDS 100% 15.000 10.500 N PSEN1 n/a
4 TRCN0000315638 CCTGTTTCGTAGCCATATTAA pLKO_005 1496 CDS 100% 15.000 10.500 N PSEN1 n/a
5 TRCN0000061739 GCAGGCATATCTCATTATGAT pLKO.1 936 CDS 100% 5.625 3.938 N PSEN1 n/a
6 TRCN0000030521 GCTGTGATTTCAGTATATGAT pLKO.1 1021 CDS 100% 5.625 3.938 N Psen1 n/a
7 TRCN0000295137 GCTGTGATTTCAGTATATGAT pLKO_005 1021 CDS 100% 5.625 3.938 N Psen1 n/a
8 TRCN0000030519 CCACTTCGTATGCTGGTTGAA pLKO.1 1069 CDS 100% 4.950 3.465 N Psen1 n/a
9 TRCN0000061738 CCATCACCTTTGGGCTTGTTT pLKO.1 1583 CDS 100% 5.625 3.375 N PSEN1 n/a
10 TRCN0000315761 CCATCACCTTTGGGCTTGTTT pLKO_005 1583 CDS 100% 5.625 3.375 N PSEN1 n/a
11 TRCN0000061741 GCTGTGGACTACATTACTGTT pLKO.1 844 CDS 100% 4.950 2.970 N PSEN1 n/a
12 TRCN0000315637 GCTGTGGACTACATTACTGTT pLKO_005 844 CDS 100% 4.950 2.970 N PSEN1 n/a
13 TRCN0000143206 GATGAGGAAGAAGATGAGGAA pLKO.1 466 CDS 100% 2.640 1.320 Y ARMH4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005267864.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01304 pDONR223 100% 99.1% 99.1% None 76_87del n/a
2 ccsbBroad304_01304 pLX_304 0% 99.1% 99.1% V5 76_87del n/a
3 TRCN0000474352 GGGTTTAATCACTCTCGTTGCGCG pLX_317 12.7% 99.1% 99.1% V5 76_87del n/a
Download CSV