Transcript: Human XM_005267921.3

PREDICTED: Homo sapiens brain enriched guanylate kinase associated (BEGAIN), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BEGAIN (57596)
Length:
6384
CDS:
3781..5562

Additional Resources:

NCBI RefSeq record:
XM_005267921.3
NBCI Gene record:
BEGAIN (57596)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005267921.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037642 GCTCTACGGAACCTTGCTCAA pLKO.1 5538 CDS 100% 4.050 5.670 N BEGAIN n/a
2 TRCN0000037643 CAGCTTCTCTGAACGCTACTA pLKO.1 5106 CDS 100% 4.950 3.465 N BEGAIN n/a
3 TRCN0000327655 CAGCTTCTCTGAACGCTACTA pLKO_005 5106 CDS 100% 4.950 3.465 N BEGAIN n/a
4 TRCN0000037640 CAGGATTCAGAGCAACTACAT pLKO.1 3954 CDS 100% 4.950 3.465 N BEGAIN n/a
5 TRCN0000327730 CAGGATTCAGAGCAACTACAT pLKO_005 3954 CDS 100% 4.950 3.465 N BEGAIN n/a
6 TRCN0000312594 ACGGAACCTTGCTCAACTGAG pLKO_005 5543 CDS 100% 4.050 2.835 N BEGAIN n/a
7 TRCN0000312592 AGGGTCTTTCTTAACGCACTT pLKO_005 5865 3UTR 100% 4.050 2.835 N BEGAIN n/a
8 TRCN0000312593 AGAGGACAACGAGCTCTATAG pLKO_005 4122 CDS 100% 10.800 6.480 N BEGAIN n/a
9 TRCN0000037639 CCTCCATTCCTGGTTTCTGTA pLKO.1 6278 3UTR 100% 4.950 2.970 N BEGAIN n/a
10 TRCN0000037641 GCTGTCCTACACCACACACAA pLKO.1 3831 CDS 100% 4.950 2.970 N BEGAIN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005267921.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03834 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03834 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466065 AGCTAACCTTCCAGCGCCAGCCTA pLX_317 16% 100% 100% V5 n/a
Download CSV