Transcript: Human XM_005268012.3

PREDICTED: Homo sapiens glucosamine-phosphate N-acetyltransferase 1 (GNPNAT1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GNPNAT1 (64841)
Length:
3759
CDS:
87..641

Additional Resources:

NCBI RefSeq record:
XM_005268012.3
NBCI Gene record:
GNPNAT1 (64841)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005268012.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420133 GTCGGAGGTTTCTAAAGTAAA pLKO_005 622 CDS 100% 13.200 18.480 N GNPNAT1 n/a
2 TRCN0000034622 GACAGATTGTTGCTACGGCAA pLKO.1 370 CDS 100% 2.160 3.024 N GNPNAT1 n/a
3 TRCN0000424460 ATTAAGTCAGGGTGGATAAAT pLKO_005 1099 3UTR 100% 15.000 12.000 N GNPNAT1 n/a
4 TRCN0000427572 ATGGGTAATAAGGAGTTATAT pLKO_005 948 3UTR 100% 15.000 10.500 N GNPNAT1 n/a
5 TRCN0000034619 GCCCTGAACAATTTATGAAAT pLKO.1 286 CDS 100% 13.200 9.240 N GNPNAT1 n/a
6 TRCN0000416317 TTGACCCAAGTCTACTCAAAG pLKO_005 112 CDS 100% 10.800 7.560 N GNPNAT1 n/a
7 TRCN0000034621 GAGTCAGAATACAGCTACATT pLKO.1 143 CDS 100% 5.625 3.938 N GNPNAT1 n/a
8 TRCN0000034623 GTTACAAGATTACCCTTGAAT pLKO.1 535 CDS 100% 5.625 3.938 N GNPNAT1 n/a
9 TRCN0000034620 CCCTTGAATGTCTACCACAAA pLKO.1 547 CDS 100% 4.950 3.465 N GNPNAT1 n/a
10 TRCN0000431362 TGCTGACTTAAATAGAGGTTT pLKO_005 224 CDS 100% 4.950 3.465 N GNPNAT1 n/a
11 TRCN0000432963 GAACATAAATTCATCCATTCC pLKO_005 402 CDS 100% 4.050 2.835 N GNPNAT1 n/a
12 TRCN0000435519 AGAGTAGAAGATGTTGTTGTT pLKO_005 438 CDS 100% 4.950 2.970 N GNPNAT1 n/a
13 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2117 3UTR 100% 4.950 2.475 Y ERAP2 n/a
14 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2118 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005268012.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03977 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03977 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474499 TGAGGTGAACGATCACGCCTAATT pLX_317 91.9% 100% 100% V5 n/a
Download CSV