Transcript: Human XM_005268465.4

PREDICTED: Homo sapiens prefoldin subunit 1 (PFDN1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PFDN1 (5201)
Length:
925
CDS:
14..361

Additional Resources:

NCBI RefSeq record:
XM_005268465.4
NBCI Gene record:
PFDN1 (5201)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005268465.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219037 AGAGCTTCAAGCCAAAGTTAT pLKO_005 55 CDS 100% 13.200 9.240 N Pfdn1 n/a
2 TRCN0000323337 AGAGCTTCAAGCCAAAGTTAT pLKO_005 55 CDS 100% 13.200 9.240 N PFDN1 n/a
3 TRCN0000323255 AGCTCGCAGACATACAGATTG pLKO_005 96 CDS 100% 10.800 7.560 N PFDN1 n/a
4 TRCN0000019008 CTTCAGTCCAAGGAAGCAATT pLKO.1 221 CDS 100% 10.800 7.560 N PFDN1 n/a
5 TRCN0000323254 CTTCAGTCCAAGGAAGCAATT pLKO_005 221 CDS 100% 10.800 7.560 N PFDN1 n/a
6 TRCN0000019005 CAGAGCTTCAAGCCAAAGTTA pLKO.1 54 CDS 100% 5.625 3.938 N PFDN1 n/a
7 TRCN0000019007 GAACAGCTAAACAGAACGAAA pLKO.1 116 CDS 100% 4.950 3.465 N PFDN1 n/a
8 TRCN0000019004 GCCAAAGTTATTGACACTCAA pLKO.1 65 CDS 100% 4.950 3.465 N PFDN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005268465.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01177 pDONR223 100% 80.8% 81.9% None (many diffs) n/a
2 ccsbBroad304_01177 pLX_304 0% 80.8% 81.9% V5 (many diffs) n/a
3 TRCN0000474721 GCGCCAGCTAGCTGGGGCACACGG pLX_317 100% 80.8% 81.9% V5 (many diffs) n/a
Download CSV