Transcript: Human XM_005268689.2

PREDICTED: Homo sapiens diacylglycerol kinase alpha (DGKA), transcript variant X13, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DGKA (1606)
Length:
2604
CDS:
478..2349

Additional Resources:

NCBI RefSeq record:
XM_005268689.2
NBCI Gene record:
DGKA (1606)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005268689.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219740 TGAGATAGGGCTCCGATTATT pLKO.1 1383 CDS 100% 15.000 21.000 N DGKA n/a
2 TRCN0000195481 CCATTGACAAAGCTAACTTGC pLKO.1 1472 CDS 100% 4.050 5.670 N DGKA n/a
3 TRCN0000006079 CGGCCAGAAGACAAGTTAGAA pLKO.1 458 5UTR 100% 5.625 4.500 N DGKA n/a
4 TRCN0000196890 GATGAGTAAAGTGGTACATAT pLKO.1 1611 CDS 100% 13.200 9.240 N DGKA n/a
5 TRCN0000006080 GCTCTGGAAGTTCCAGTATAT pLKO.1 1320 CDS 100% 13.200 9.240 N DGKA n/a
6 TRCN0000219741 ATGTTCCTGATAGCCGGATTT pLKO.1 1409 CDS 100% 10.800 7.560 N DGKA n/a
7 TRCN0000006082 CCAAATCTATACCAAGCTCAA pLKO.1 2139 CDS 100% 4.050 2.835 N DGKA n/a
8 TRCN0000006081 GCTAAATATGTCCAAGGAGAT pLKO.1 248 5UTR 100% 4.050 2.835 N DGKA n/a
9 TRCN0000199540 CTCCCGAGGCTCTGTACATTG pLKO.1 2409 3UTR 100% 3.600 2.520 N DGKA n/a
10 TRCN0000006078 CCTCACAGTATTTATTATCCT pLKO.1 2471 3UTR 100% 3.000 2.100 N DGKA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005268689.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06081 pDONR223 100% 83.9% 81.2% None (many diffs) n/a
2 ccsbBroad304_06081 pLX_304 0% 83.9% 81.2% V5 (many diffs) n/a
3 ccsbBroadEn_14606 pDONR223 0% 83.9% 81.2% None (many diffs) n/a
4 ccsbBroad304_14606 pLX_304 0% 83.9% 81.2% V5 (many diffs) n/a
5 TRCN0000467698 TGGTAAGTTTTACCCAGAACCTTT pLX_317 16.3% 83.9% 81.2% V5 (many diffs) n/a
6 TRCN0000488578 CAGAACCTGAATACATGTAGCCGC pLX_317 12.2% 83.9% 81.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV