Transcript: Human XM_005268706.5

PREDICTED: Homo sapiens anoctamin 6 (ANO6), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANO6 (196527)
Length:
6060
CDS:
323..3022

Additional Resources:

NCBI RefSeq record:
XM_005268706.5
NBCI Gene record:
ANO6 (196527)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005268706.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134143 CAGCGAAGAATTGACTTTGTT pLKO.1 485 CDS 100% 5.625 7.875 N ANO6 n/a
2 TRCN0000137490 GCCATGTATGTCAGCATAGAA pLKO.1 5099 3UTR 100% 5.625 7.875 N ANO6 n/a
3 TRCN0000136872 CGATGTACTCACGTAGTGATA pLKO.1 1562 CDS 100% 4.950 6.930 N ANO6 n/a
4 TRCN0000133946 CACCTCAAAGATATGACGAAA pLKO.1 2933 CDS 100% 4.950 3.960 N ANO6 n/a
5 TRCN0000134775 CCTTGGATCTTATCAGGAAAT pLKO.1 1137 CDS 100% 10.800 7.560 N ANO6 n/a
6 TRCN0000134710 GCTTCAGTTATTGGGATCATT pLKO.1 1691 CDS 100% 5.625 3.938 N ANO6 n/a
7 TRCN0000285872 GAGAATCACCTCAAAGATATT pLKO_005 2927 CDS 100% 13.200 7.920 N Tada1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005268706.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09792 pDONR223 100% 98.2% 97.4% None (many diffs) n/a
2 ccsbBroad304_09792 pLX_304 0% 98.2% 97.4% V5 (many diffs) n/a
3 TRCN0000477050 CAAAGAATCCAGTTCCGTGAGCGG pLX_317 15.4% 98.2% 97.4% V5 (many diffs) n/a
Download CSV