Transcript: Human XM_005269708.1

PREDICTED: Homo sapiens G protein-coupled receptor kinase 5 (GRK5), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GRK5 (2869)
Length:
2448
CDS:
220..1896

Additional Resources:

NCBI RefSeq record:
XM_005269708.1
NBCI Gene record:
GRK5 (2869)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005269708.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234563 TACGACAACTTGCACGTATTT pLKO_005 2154 3UTR 100% 13.200 18.480 N GRK5 n/a
2 TRCN0000234561 GGGAGAACCATTCCACGAATA pLKO_005 585 CDS 100% 10.800 15.120 N GRK5 n/a
3 TRCN0000234562 TGAACGTGTTTGGACCTAATG pLKO_005 1694 CDS 100% 10.800 15.120 N GRK5 n/a
4 TRCN0000195681 CCTTAGAAGTGGAAGTAGTGG pLKO.1 1946 3UTR 100% 2.640 3.696 N GRK5 n/a
5 TRCN0000010557 GTGAGACTTTGAGGGTGTATA pLKO.1 2286 3UTR 100% 13.200 10.560 N GRK5 n/a
6 TRCN0000238793 TAGATGATTATGGCCACATTA pLKO_005 1079 CDS 100% 13.200 9.240 N GRK5 n/a
7 TRCN0000234560 TGGACTCCGTGGCAGAATATG pLKO_005 374 CDS 100% 13.200 9.240 N GRK5 n/a
8 TRCN0000000842 ACGAGATGATAGAAACAGAAT pLKO.1 1661 CDS 100% 4.950 3.465 N GRK5 n/a
9 TRCN0000000841 GAAGGAAATTATGACCAAGTA pLKO.1 429 CDS 100% 4.950 3.465 N GRK5 n/a
10 TRCN0000000843 CCACCACATAAACTCAAACCA pLKO.1 1845 CDS 100% 3.000 2.100 N GRK5 n/a
11 TRCN0000196900 GCAATAGAAATCCAATTGGAT pLKO.1 2134 3UTR 100% 3.000 2.100 N GRK5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005269708.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488904 TAAACTCATCTGACCCGGGACTTC pLX_317 14.3% 94.5% 94.5% V5 (not translated due to prior stop codon) 50_51ins96 n/a
Download CSV