Transcript: Human XM_005269998.1

PREDICTED: Homo sapiens glycerol-3-phosphate acyltransferase, mitochondrial (GPAM), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GPAM (57678)
Length:
6527
CDS:
356..2842

Additional Resources:

NCBI RefSeq record:
XM_005269998.1
NBCI Gene record:
GPAM (57678)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005269998.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413369 CCTCTATTCGCAACTCATAAT pLKO_005 3061 3UTR 100% 13.200 18.480 N GPAM n/a
2 TRCN0000421509 GGTAGAGACACGTCCATTAAT pLKO_005 1685 CDS 100% 15.000 12.000 N GPAM n/a
3 TRCN0000418865 CTTAGTGCTGCTGGGTAATTT pLKO_005 3224 3UTR 100% 15.000 10.500 N GPAM n/a
4 TRCN0000418561 GTGTAGCAAGAGGTGTTATTA pLKO_005 1494 CDS 100% 15.000 10.500 N GPAM n/a
5 TRCN0000420555 CCAGTTCATAGATCCCATATT pLKO_005 1037 CDS 100% 13.200 9.240 N GPAM n/a
6 TRCN0000436820 ACGACGAAGGCTCGATGAAAC pLKO_005 1183 CDS 100% 10.800 7.560 N GPAM n/a
7 TRCN0000036040 CCAGCAGTTTATCACCTTCTT pLKO.1 2497 CDS 100% 4.950 3.465 N GPAM n/a
8 TRCN0000036041 CCCAATCTTCAGTACCTTGAT pLKO.1 1138 CDS 100% 4.950 3.465 N GPAM n/a
9 TRCN0000036043 GCAAGCGTTGTTACCAGCTAT pLKO.1 1630 CDS 100% 4.950 3.465 N GPAM n/a
10 TRCN0000036042 GCTGGGAAATTGTGTCACAAT pLKO.1 1972 CDS 100% 4.950 3.465 N GPAM n/a
11 TRCN0000036039 GCTGCTGAATTAAACCCTGAT pLKO.1 794 CDS 100% 4.050 2.430 N GPAM n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005269998.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08758 pDONR223 100% 99.9% 99.7% None 11C>A;241C>A n/a
2 ccsbBroad304_08758 pLX_304 0% 99.9% 99.7% V5 11C>A;241C>A n/a
3 TRCN0000469748 ACCGAGTCGATACGCACCCAGGAC pLX_317 15.1% 99.9% 99.7% V5 11C>A;241C>A n/a
Download CSV